|
| Status |
Public on Jan 04, 2017 |
| Title |
Total mNET-Seq siLuc rep1 |
| Sample type |
SRA |
| |
|
| Source name |
Total polymerase, siLuc control for EXOC3 KD
|
| Organism |
Homo sapiens |
| Characteristics |
cell line: HeLa genotype/variation: siLuc control for EXOC3 KD molecule subtype: Polymerase bound RNA
|
| Treatment protocol |
1% Empigen was aded IP buffer and IP washing buffer. siRNAs were transfected for 60-72 hrs accroding to RNAiMAX reagent protocol.
|
| Growth protocol |
HeLa cells were maintained in DMEM with 10% fetal bovine serum.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Nascent RNAs were prufied from Pol II IP products of solubilized chromatin. Libraries were prepared acooding to the protocols of Trueseq small RNA sequencing preparation kit (Illumina) for mNET-seq; Ultra directional RNA sequencing preparation kit (NEB) for chrRNA and Np RNA-seq.
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina HiSeq 2500 |
| |
|
| Data processing |
library strategy: mNET-Seq Adapter trimming with Cutadapt v. 1.8.3 in paired end mode with the following parameters: -A GATCGTCGGACTGTAGAACTCTGAAC -a TGGAATTCTCGGGTGCCAAGG --minimum-length 10 Alignment with Tophat v. 2.0.13 and the parameters -g 1 -r 3000 --no-coverage-search to hg19 Extraction of properly paired, properly mapped reads (samflags 0x63, 0x93, 0x53, 0xA3) with SAMtools v. 1.2 For mNET-Seq profiles only the most 3’ nucleotide of the second read was used with the strandedness of the first read BigWig files were generated from the above bedgraph files through the bedGraphToBigWig tool (Kent et al., 2002). Data was visualized with Bedtools v. 2.23.0 (genomeCoverageBed). Genome_build: hg19 Supplementary_files_format_and_content: bigwig files: genome-coverage files for all samples
|
| |
|
| Submission date |
Jul 18, 2016 |
| Last update date |
May 15, 2019 |
| Contact name |
Monika Gullerova |
| E-mail(s) |
monika.gullerova@path.ox.ac.uk
|
| Phone |
+44794220892
|
| Organization name |
University of Oxford
|
| Department |
Sir William Dunn School of Pathology
|
| Street address |
South Parks Road
|
| City |
Oxford |
| ZIP/Postal code |
OX1 3RE |
| Country |
United Kingdom |
| |
|
| Platform ID |
GPL16791 |
| Series (1) |
| GSE81662 |
Nuclear Surveillance of long intervening noncoding RNA |
|
| Relations |
| Reanalyzed by |
GSE97009 |
| BioSample |
SAMN05414001 |
| SRA |
SRX1958777 |