|
| Status |
Public on Dec 17, 2018 |
| Title |
5358_NAcc_neg (ATAC-Seq) |
| Sample type |
SRA |
| |
|
| Source name |
NeuN negative nuclei sorted from nucleus accumbens (NAcc)
|
| Organism |
Homo sapiens |
| Characteristics |
cell type: NeuN neg tissue: nucleus accumbens (NAcc) individual id: 5358
|
| Treatment protocol |
ATAC-seq was performed as described in Buenrostro et al. 2015 using 100,000 neuronal and non-neuronal nuclei isolated from nucleus accumbens and prefrontal cortex (BA9) tissues (for samples with "_pos" or "_neg" at end of sample ID) and sorted via FACS based on NeuN staining as in Montano et al. 2013.
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
Nextera DNA library prep kit (cat #:FC-121-1031, Illumina)
|
| |
|
| Library strategy |
ATAC-seq |
| Library source |
genomic |
| Library selection |
other |
| Instrument model |
Illumina HiSeq 4000 |
| |
|
| Data processing |
We trimmed reads of their adapter sequences using trimadap (v0.1) with the following parameters: trimadap-mt -3 CTGTCTCTTATACACATCTCCGAGCCCACGAGA ${READ1}; trimadap-mt -3 CTGTCTCTTATACACATCTGACGCTGCCGACGA ${READ2}. We then aligned these trimmed reads to the hg19 build of the human genome (including autosomes, sex chromosomes, mitochondrial sequence, unplaced sequence, and unlocalized sequence) using Bowtie214 (v2.2.5) with alignment parameters: bowtie2 -X 2000 --local --dovetail. Potential PCR duplicate reads were marked using MarkDuplicates from the Picard library (v2.2.1). Peaks were called using MACS (v2.1.0) on a metasample formed by combining all non-duplicate-marked reads with a mapping quality > 30 from the 22 samples: macs2 callpeaks --nomodel --nolambda --call-summits -t ${BAMS[@]}. We excluded those peaks overlapping the ENCODE mappability consensus blacklist regions (http://hgdownload.cse.ucsc.edu/goldenPath/hg19/encodeDCC/wgEncodeMapability/) and the blacklist for ATAC-seq created by Buenrostro et al. (https://sites.google.com/site/atacseqpublic/atac-seq-analysis-methods/mitochondrialblacklists-1). We extended +/- 250 bp from the summit of peak and merged overlapping peaks to form our initial set of peaks. Genome_build: hg19/GRCh37 Supplementary_files_format_and_content: Matrix of read count data for each genome location for all samples.
|
| |
|
| Submission date |
Mar 14, 2017 |
| Last update date |
May 15, 2019 |
| Contact name |
Andrew P. Feinberg |
| Organization name |
Johns Hopkins University School of Medicine
|
| Street address |
855 N. Wolfe St
|
| City |
Baltimore |
| State/province |
MD |
| ZIP/Postal code |
21205 |
| Country |
USA |
| |
|
| Platform ID |
GPL20301 |
| Series (2) |
| GSE96614 |
Neuronal brain region-specific DNA methylation and chromatin accessibility are associated with neuropsychiatric trait heritability [ATAC-Seq] |
| GSE96615 |
Neuronal brain region-specific DNA methylation and chromatin accessibility are associated with neuropsychiatric trait heritability |
|
| Relations |
| BioSample |
SAMN06603275 |
| SRA |
SRX2640528 |