NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM2536642 Query DataSets for GSM2536642
Status Public on Dec 17, 2018
Title 5347_NAcc_pos (ATAC-Seq)
Sample type SRA
 
Source name NeuN positive nuclei sorted from nucleus accumbens (NAcc)
Organism Homo sapiens
Characteristics cell type: NeuN pos
tissue: nucleus accumbens (NAcc)
individual id: 5347
Treatment protocol ATAC-seq was performed as described in Buenrostro et al. 2015 using 100,000 neuronal and non-neuronal nuclei isolated from nucleus accumbens and prefrontal cortex (BA9) tissues (for samples with "_pos" or "_neg" at end of sample ID) and sorted via FACS based on NeuN staining as in Montano et al. 2013.
Extracted molecule genomic DNA
Extraction protocol Nextera DNA library prep kit (cat #:FC-121-1031, Illumina)
 
Library strategy ATAC-seq
Library source genomic
Library selection other
Instrument model Illumina HiSeq 4000
 
Data processing We trimmed reads of their adapter sequences using trimadap (v0.1) with the following parameters: trimadap-mt -3 CTGTCTCTTATACACATCTCCGAGCCCACGAGA ${READ1}; trimadap-mt -3 CTGTCTCTTATACACATCTGACGCTGCCGACGA ${READ2}. We then aligned these trimmed reads to the hg19 build of the human genome (including autosomes, sex chromosomes, mitochondrial sequence, unplaced sequence, and unlocalized sequence) using Bowtie214 (v2.2.5) with alignment parameters: bowtie2 -X 2000 --local --dovetail. Potential PCR duplicate reads were marked using MarkDuplicates from the Picard library (v2.2.1).
Peaks were called using MACS (v2.1.0) on a metasample formed by combining all non-duplicate-marked reads with a mapping quality > 30 from the 22 samples: macs2 callpeaks --nomodel --nolambda --call-summits -t ${BAMS[@]}. We excluded those peaks overlapping the ENCODE mappability consensus blacklist regions (http://hgdownload.cse.ucsc.edu/goldenPath/hg19/encodeDCC/wgEncodeMapability/) and the blacklist for ATAC-seq created by Buenrostro et al. (https://sites.google.com/site/atacseqpublic/atac-seq-analysis-methods/mitochondrialblacklists-1). We extended +/- 250 bp from the summit of peak and merged overlapping peaks to form our initial set of peaks.
Genome_build: hg19/GRCh37
Supplementary_files_format_and_content: Matrix of read count data for each genome location for all samples.
 
Submission date Mar 14, 2017
Last update date May 15, 2019
Contact name Andrew P. Feinberg
Organization name Johns Hopkins University School of Medicine
Street address 855 N. Wolfe St
City Baltimore
State/province MD
ZIP/Postal code 21205
Country USA
 
Platform ID GPL20301
Series (2)
GSE96614 Neuronal brain region-specific DNA methylation and chromatin accessibility are associated with neuropsychiatric trait heritability [ATAC-Seq]
GSE96615 Neuronal brain region-specific DNA methylation and chromatin accessibility are associated with neuropsychiatric trait heritability
Relations
BioSample SAMN06603266
SRA SRX2640537

Supplementary data files not provided
SRA Run SelectorHelp
Raw data are available in SRA
Processed data are available on Series record

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap