NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM2631743 Query DataSets for GSM2631743
Status Public on Sep 01, 2017
Title SKOV_URT_1
Sample type SRA
 
Source name SKOV3ip1 cell line
Organism Homo sapiens
Characteristics cell type: Ovarian serous cystadenocarcinoma
treatment: none
Growth protocol grown in DMEM/F12 (50/50) medium (Wisent), supplemented with 10 % fetal bovine serum and 2 mM L-glutamine. Cell propagation and passaging were as recommended by ATCC (American Type Culture Collection). Cells were trypsinized and collected in 5X106 pellets resuspended in 700ul TRIzol (Ambion) and kept at -80°C until RNA extraction
Extracted molecule total RNA
Extraction protocol cDNA library produced with TGIRT (thermostable group II reverse transcriptase)
Purified total RNA was ribodepleted by using a RiboZero Gold (Human/Mouse/Rat) kit (Illumina) and the resulting RNA were then used directly for library construction.
cDNAs were synthesized via TGIRT template-switching with either 0.5 or 1µM TGIRT-III reverse transcriptase (Ingex, LLC) for 15 min at 60o C, during which a DNA oligonucleotide containing the complement of an Illumina Read 2 sequencing primer-binding site becomes seamlessly linked to the 5’ cDNA end. After reaction cleanup, a 5’ adenylated DNA oligonucleotide containing the complement of an Illumina Read 1 sequencing primer-binding site is then ligated to the 3’ cDNA end with Thermostable 5’ AppDNA / RNA Ligase (New England Biolabs). Properly ligated cDNAs were amplified by PCR (12 cycles) to synthesize the second strand and add Illumina flowcell capture and index sequences. Libraries were size-selected with Ampure XP beads (Beckman-Coulter) and evaluated on an Agilent 2100 Bioanalyzer
 
Library strategy RNA-Seq
Library source transcriptomic
Library selection cDNA
Instrument model Illumina HiSeq 4000
 
Description Total RNA ribodepleted, non-fragmented
Data processing Reads were treated with Cutadapt (using parameters -g GATCGTCGGACTGTAGAACTCTGAACGTGTAGATCTCGGTGGTCGCCGTATCATT -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG --minimum-length 2) and Trimmomatic (with TRAILING:30)
The resulting reads were aligned to the build hg38 using STAR (--outSAMprimaryFlag AllBestScore, --alignIntronMax 1250000), unmapped reads being re-aligned with Bowtie2 (-q -I 13).
CoCo (http://gitlabscottgroup.med.usherbrooke.ca/scott-group/coco) was used to produce read counts per genes and associated CPM and TPM values from the Ensembl (v87) annotation modified with CoCo.
Genome_build: hg38
Supplementary_files_format_and_content: comma-separated-value (csv) files holding the name of every gene and their abundance value (raw counts, CPM or TPM) for each dataset
 
Submission date May 18, 2017
Last update date May 15, 2019
Contact name Michelle S Scott
E-mail(s) michelle.scott@usherbrooke.ca
Organization name University of Sherbrooke
Department Biochemistry
Street address 3201 Jean Mignault
City Sherbrooke
State/province Quebec
ZIP/Postal code J1E 4K8
Country Canada
 
Platform ID GPL20301
Series (1)
GSE99065 Simultaneous detection and relative quantification of coding and non-coding RNA using a single sequencing reaction
Relations
BioSample SAMN07140776
SRA SRX2833970

Supplementary data files not provided
SRA Run SelectorHelp
Raw data are available in SRA
Processed data are available on Series record

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap