|
| Status |
Public on Sep 01, 2017 |
| Title |
SKOV_URT_2 |
| Sample type |
SRA |
| |
|
| Source name |
SKOV3ip1 cell line
|
| Organism |
Homo sapiens |
| Characteristics |
cell type: Ovarian serous cystadenocarcinoma
treatment: none
|
| Growth protocol |
grown in DMEM/F12 (50/50) medium (Wisent), supplemented with 10 % fetal bovine serum and 2 mM L-glutamine. Cell propagation and passaging were as recommended by ATCC (American Type Culture Collection). Cells were trypsinized and collected in 5X106 pellets resuspended in 700ul TRIzol (Ambion) and kept at -80°C until RNA extraction
|
| Extracted molecule |
total RNA |
| Extraction protocol |
cDNA library produced with TGIRT (thermostable group II reverse transcriptase)
Purified total RNA was ribodepleted by using a RiboZero Gold (Human/Mouse/Rat) kit (Illumina) and the resulting RNA were then used directly for library construction.
cDNAs were synthesized via TGIRT template-switching with either 0.5 or 1µM TGIRT-III reverse transcriptase (Ingex, LLC) for 15 min at 60o C, during which a DNA oligonucleotide containing the complement of an Illumina Read 2 sequencing primer-binding site becomes seamlessly linked to the 5’ cDNA end. After reaction cleanup, a 5’ adenylated DNA oligonucleotide containing the complement of an Illumina Read 1 sequencing primer-binding site is then ligated to the 3’ cDNA end with Thermostable 5’ AppDNA / RNA Ligase (New England Biolabs). Properly ligated cDNAs were amplified by PCR (12 cycles) to synthesize the second strand and add Illumina flowcell capture and index sequences. Libraries were size-selected with Ampure XP beads (Beckman-Coulter) and evaluated on an Agilent 2100 Bioanalyzer
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina HiSeq 4000 |
| |
|
| Description |
Total RNA ribodepleted, non-fragmented
|
| Data processing |
Reads were treated with Cutadapt (using parameters -g GATCGTCGGACTGTAGAACTCTGAACGTGTAGATCTCGGTGGTCGCCGTATCATT -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG --minimum-length 2) and Trimmomatic (with TRAILING:30)
The resulting reads were aligned to the build hg38 using STAR (--outSAMprimaryFlag AllBestScore, --alignIntronMax 1250000), unmapped reads being re-aligned with Bowtie2 (-q -I 13).
CoCo (http://gitlabscottgroup.med.usherbrooke.ca/scott-group/coco) was used to produce read counts per genes and associated CPM and TPM values from the Ensembl (v87) annotation modified with CoCo.
Genome_build: hg38
Supplementary_files_format_and_content: comma-separated-value (csv) files holding the name of every gene and their abundance value (raw counts, CPM or TPM) for each dataset
|
| |
|
| Submission date |
May 18, 2017 |
| Last update date |
May 15, 2019 |
| Contact name |
Michelle S Scott |
| E-mail(s) |
michelle.scott@usherbrooke.ca
|
| Organization name |
University of Sherbrooke
|
| Department |
Biochemistry
|
| Street address |
3201 Jean Mignault
|
| City |
Sherbrooke |
| State/province |
Quebec |
| ZIP/Postal code |
J1E 4K8 |
| Country |
Canada |
| |
|
| Platform ID |
GPL20301 |
| Series (1) |
| GSE99065 |
Simultaneous detection and relative quantification of coding and non-coding RNA using a single sequencing reaction |
|
| Relations |
| BioSample |
SAMN07140775 |
| SRA |
SRX2833971 |
