 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Sep 16, 2017 |
| Title |
pLenti HCT116 Drosha KO cells rep 1 |
| Sample type |
SRA |
| |
|
| Source name |
ATCC CCL-247; Drosha KO cells provided by Narry Kim, ref: Kim Y.K., Kim B., Kim V.N. (2016). Re-evaluation of the roles of DROSHA, Export in 5, and DICER in microRNA biogenesis. Proc Natl Acad Sci U S A. 113(13):E1881-9.
|
| Organism |
Homo sapiens |
| Characteristics |
genotype/variation: Drosha k.o.
cell line: HCT116
tissue: colon
treatment/infection: Cells infected with empty pLenti and selected with 3ug/mL puromycin for 2 days. Cells were plated for 50hours and an Ago-pull down was performed and the small RNA (19-23nts) sequenced.
|
| Treatment protocol |
Either parental or Drosha k.o. HCT116 cells were infected with pLenti or pLenti-CD95LMUTNP overnight; puromycin selection was done for 2 days and then cells were plated for 50hrs post selection before cells pellets were isolated and frozen; Ago pull-down was then done on the frozen pellets. Total time from addition of lentiviruses to freezing pellets was 122 hours.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Cells were lysed in NP40 lysis buffer (20 mM Tris, pH 7.5, 150 mM NaCl, 2 mM EDTA, 1% (v/v) NP40, supplemented with phosphatase inhibitors) on ice for 15 minutes. The lysate was sonicated 3 times for 30 s at 60% amplitude (Sonics, VCX130) and cleared by centrifugation at 12,000g for 20 minutes. AGO1-4 were pulled down by using 500 mg of Flag-GST-T6B peptide (Hauptmann et al., 2015) and with 60 ml anti-Flag M2 magnetic beads (Sigma-Aldrich) for 2 hrs at 4°C. The pull-down was washed 3 times in NP40 lysis buffer. During the last wash, 10% of beads were removed and incubated at 95°C for 5 minutes in 2x SDS-PAGE sample buffer. Samples were run on a 4-12% SDS-PAGE and transferred to nitrocellulose membrane. The pull-down efficiency was determined by immunoblotting against AGO1 and AGO2 (Abcam 98056 and 32381). To the remaining beads 500 µl TRIzol reagent were added and the RNA extracted according to the manufacturer’s instructions. The RNA pellet was diluted in 20 µl of water. The sample was split and half of the sample was dephosphorylated with 0.5 U/μl of CIP alkaline phosphatase at 37°C for 15 min and subsequently radiolabeled with 0.5 μCi γ-32P-ATP and 1 U/μl of T4 PNK kinase for 20 min at 37°C. The AGO1-4 interacting RNAs were visualized on a 15% urea-PAGE. The remaining RNA was taken through a small RNA library preparation as previously descried (Hafner et al., 2012). Briefly, RNA was ligated with 3’ adenylated adapters and separated on a 15% denaturing urea-PAGE. The RNA corresponding to insert size of 19-35 nt was eluted from the gel, ethanol precipitated followed by 5’ adapter ligation. The samples were separated on a 12% Urea-PAGE and extracted from the gel. Reverse transcription was performed using Superscript III reverse transcriptase and the cDNA amplified by PCR. The cDNA was sequenced on Illumina HiSeq 3000. Adapter sequences: Adapter 1 – NNTGACTGTGGAATTCTCGGGTGCCAAGG; Adapter 2 – NNACACTCTGGAATTCTCGGGTGCCAAGG, Adapter 3 – NNACAGAGTGGAATTCTCGGGTGCCAAGG, Adapter 4 – NNGCGATATGGAATTCTCGGGTGCCAAGG, Adapter 47 – NNTCTGTGTGGAATTCTCGGGTGCCAAGG, Adapter 48 – NNCAGCATTGGAATTCTCGGGTGCCAAGG, Adapter 49 – NNATAGTATGGAATTCTCGGGTGCCAAGG, Adapter 50 – NNTCATAGTGGAATTCTCGGGTGCCAAGG. RT primer sequence: GCCTTGGCACCCGAGAATTCCA; PCR primer sequences: CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA. To identify CD95L derived small RNAs all reads (4 conditions in duplicate) after removal of the adaptor sequences were BLASTED against the CD95L ORF (derived from NM_000639.1). Only reads were considered with an evalue of less than 0.05 and 100% identity across the entire length of the read.
The quality and quantity of the RNA samples was checked using an Agilent bio-analyzer. Small RNA-SEQ libraries were generated using Illumina small RNA SEQ kits using the Illumina provided protocol. Two small RNA-SEQ sub-libraries were generated: one containing library fragments 140-150 bp in size and one containing library fragments 150-200 bp in size (both including the sequencing adator of about 130bp).
sequenced on an Illumina HiSEQ4000 using Illumina provided reagents and protocols
|
| |
|
| Library strategy |
RIP-Seq |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
Illumina HiSeq 4000 |
| |
|
| Description |
SmallRNA_pLenti_50hrs_Drosha_ko_rep1
|
| Data processing |
Sequenced reads were mapped to hg38 human genome using Tophat and bowtie2
raw counts were calculated by HTSeq
Genome_build: hg38
Supplementary_files_format_and_content: Excel sheet with normalized read counts for each sample comparison of interest, along with log2FoldChange values, p-values and adjusted p-values.
|
| |
|
| Submission date |
Jul 11, 2017 |
| Last update date |
Sep 08, 2022 |
| Contact name |
Marcus Peter |
| E-mail(s) |
m-peter@northwestern.edu
|
| Organization name |
Northwestern University Feinberg School of Medicine
|
| Street address |
303 East Superior Street, Lurie 6-123
|
| City |
Chicago |
| State/province |
IL |
| ZIP/Postal code |
60611 |
| Country |
USA |
| |
|
| Platform ID |
GPL20301 |
| Series (2) |
| GSE87817 |
CD95L derived si- and shRNAs kill cancer cells through an RNAi mechanism by targeting survival genes |
| GSE101166 |
CD95L derived si- and shRNAs kill cancer cells through an RNAi mechanism by targeting survival genes [AGOpulldownRNAseq.sm] |
|
| Relations |
| BioSample |
SAMN07342235 |
| SRA |
SRX2995782 |
| Supplementary data files not provided |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data are available on Series record |
|
|
|
|
 |
