|
| Status |
Public on Sep 12, 2011 |
| Title |
RNA Capture-Seq resolves the deep complexity of the human transcriptome (454) |
| Organism |
Homo sapiens |
| Experiment type |
Expression profiling by high throughput sequencing
|
| Summary |
Transcriptomic analyses have revealed an unexpected complexity of the human transcriptome, whose breadth and depth exceeds current RNA sequencing capacity 1-3. Here we combine tiling arrays and RNA sequencing technologies, in an approach we term RNA Capture-Seq, to enable the assembly and characterisation of transcripts whose expression level is below the detection limits of conventional sequencing approaches. By this technique we identify novel exons and splicing patterns to even well-studied genes, such as the p53 and Hox loci, and expose widespread, regulated and remarkably complex noncoding transcription in intergenic regions. We show that unassigned tags observed in conventional RNA sequencing datasets are not noise but can derive from rare transcripts fully assembled by RNA Capture-Seq. We expect RNA Capture-Seq to prove an invaluable technique for future research into gene expression and its relationship to phenotypic variation.
|
| |
|
| Overall design |
Application of RNA Capture sequencing from human fibroblasts for identifying rare novel transcripts.
Hybridization enhancing oligos are designed to cover the full sequencing adaptor and MID sequences during hybridisation.
Enhancing Oligo A 5 CCATCTCATCCCTGCGTGTCTCCGACTCAG/3ddc/
Enhancing Oligo B 5' CCTATCCCCTGTGTGCCTTGGCAGTCTCAG/3ddc/
|
| |
|
| Contributor(s) |
Mercer TR, Rinn JL |
| Citation(s) |
22081020 |
| Submission date |
May 03, 2011 |
| Last update date |
May 15, 2019 |
| Contact name |
Tim R. Mercer |
| Organization name |
Garvan
|
| Lab |
Prof. John Mattick
|
| Street address |
384 Victoria Street Darlinghurst NSW 2010
|
| City |
Sydney |
| State/province |
New South Wales |
| ZIP/Postal code |
2010 |
| Country |
Australia |
| |
|
| Platforms (1) |
| GPL14603 |
454 GS FLX Titanium (Homo sapiens) |
|
| Samples (16)
|
|
| This SubSeries is part of SuperSeries: |
| GSE29041 |
RNA Capture-Seq resolves the deep complexity of the human transcriptome |
|
| Relations |
| SRA |
SRP006702 |
| BioProject |
PRJNA142905 |
Less...
More...