|
| Status |
Public on Mar 01, 2015 |
| Title |
Quantitative modeling of transcription factor binding specificities using DNA shape |
| Organism |
Homo sapiens |
| Experiment type |
Genome binding/occupancy profiling by high throughput sequencing
|
| Summary |
The SELEX-seq platform was used to generate DNA-binding affinity predictions for the human Max transcription factor. This experiment was performed as part of a cross-validation study comparing the accuracy of DNA shape-augmented TF binding specificity models across two different platforms (SELEX-seq and gcPBM)
|
| |
|
| Overall design |
Two rounds of SELEX were performed on Max protein as described in Slattery et al, Cell, 2011 (PMID 22153072). Briefly, His-tagged Max was incubated with a randomized 16mer oligonucleotide library (GTTCAGAGTTCTACAGTCCGACGATCTGG[ACGT]{16}CCAGAACTCGTATGCCGTCTTCTGCTTG). Max bound DNA was amplified and sequenced as described (Slattery et al, 2011).
|
| |
|
| Contributor(s) |
Mann RS, Bussemaker HJ, Gordân R |
| Citation(s) |
25775564 |
| Submission date |
Aug 07, 2014 |
| Last update date |
May 15, 2019 |
| Contact name |
Namiko Abe |
| E-mail(s) |
abenamiko@gmail.com
|
| Phone |
212-305-2111
|
| Organization name |
Columbia University
|
| Department |
Biochemistry and Molecular Biophysics
|
| Lab |
Richard Mann
|
| Street address |
701 W. 168th St HHSC1104
|
| City |
New York |
| State/province |
NY |
| ZIP/Postal code |
10032 |
| Country |
USA |
| |
|
| Platforms (1) |
| GPL16791 |
Illumina HiSeq 2500 (Homo sapiens) |
|
| Samples (1) |
|
| Relations |
| BioProject |
PRJNA257744 |
| SRA |
SRP045333 |
