NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM1067862 Query DataSets for GSM1067862
Status Public on May 08, 2013
Title NOP58 rep B
Sample type SRA
 
Source name HEK293
Organism Homo sapiens
Characteristics cell line: HEK293
antibody: Nop58; goat polyclonal IgG; sc-23705
antibody vendor: Santa Cruz Biotechnology
3' adaptor: 5' TGGAATTCTCGGGTGCCAAGG 3'
Growth protocol HEK293 and HeLa cells were routinely generated by replating every 3 d on T75 flasks (Falcon, 353133) in DMEM supplemented with 10% FCS.
Extracted molecule total RNA
Extraction protocol PAR-CLIP samples were extracted following the PAR-CLIP method (Hafner et al. 2010; PMID: 20371350).
For HEK293 small RNA-seq samples total RNA was extracted with TRI Reagent, radiolabeled and size-selected on a PAA gel.
For HeLa Ago2-IP samples lysates were clarified and Ago2-RNA complexes isolated with an antibody, Ago2-associated RNA TRI Reagent-extracted, radiolabeled and size-selected on a PAA gel.
PAR-CLIP library preparation as described in (Hafner et al. 2010; PMID: 20371350).
Small RNA libraries for HEK293 cells were constructed as described in (Hafner et al. 2008; PMID: 18158127).
For HeLa Ago2 IP-seq samples Ago2-associated RNAs were extracted and used to prepare cDNA libraries as described in (Hafner et al. 2008; PMID: 18158127).
 
Library strategy RNA-Seq
Library source transcriptomic
Library selection cDNA
Instrument model Illumina HiSeq 2000
 
Data processing The raw reads were processed on the CLIPZ server (www.clipz.unibas.ch; Khorshid et al., Nucleic Acids Research 2011, 39:D245 (PMID 21087992)).
For subsequent analyses only uniquely mapped reads were considered.
Genome_build: hg19 Feb 2009
Supplementary_files_format_and_content: bed files with genomic coordinates of reads mapped; scores represent the number of reads
 
Submission date Jan 22, 2013
Last update date May 15, 2019
Contact name Andreas R Gruber
E-mail(s) agruber@tbi.univie.ac.at
Organization name University of Basel
Department Biozentrum
Lab Zavolan
Street address Klingelbergstrasse 50-70
City Basel
ZIP/Postal code 4056
Country Switzerland
 
Platform ID GPL11154
Series (1)
GSE43666 Insights into snoRNA biogenesis and processing from PAR-CLIP of snoRNA core proteins and small RNA sequencing
Relations
SRA SRX218957
BioSample SAMN01893945

Supplementary file Size Download File type/resource
GSM1067862_ETHZ_BSSE_100205_433DMAAXX_8.bed.gz 6.8 Mb (ftp)(http) BED
SRA Run SelectorHelp
Raw data are available in SRA
Processed data provided as supplementary file

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap