 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on May 08, 2013 |
| Title |
FBL |
| Sample type |
SRA |
| |
|
| Source name |
HEK293
|
| Organism |
Homo sapiens |
| Characteristics |
cell line: HEK293
antibody: Fibrillarin; mouse monoclonal; AFB01
antibody vendor: Cytoskeleton, Inc.
lot number: 011
3' adaptor: 5' TGGAATTCTCGGGTGCCAAGG 3'
|
| Growth protocol |
HEK293 and HeLa cells were routinely generated by replating every 3 d on T75 flasks (Falcon, 353133) in DMEM supplemented with 10% FCS.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
PAR-CLIP samples were extracted following the PAR-CLIP method (Hafner et al. 2010; PMID: 20371350).
For HEK293 small RNA-seq samples total RNA was extracted with TRI Reagent, radiolabeled and size-selected on a PAA gel.
For HeLa Ago2-IP samples lysates were clarified and Ago2-RNA complexes isolated with an antibody, Ago2-associated RNA TRI Reagent-extracted, radiolabeled and size-selected on a PAA gel.
PAR-CLIP library preparation as described in (Hafner et al. 2010; PMID: 20371350).
Small RNA libraries for HEK293 cells were constructed as described in (Hafner et al. 2008; PMID: 18158127).
For HeLa Ago2 IP-seq samples Ago2-associated RNAs were extracted and used to prepare cDNA libraries as described in (Hafner et al. 2008; PMID: 18158127).
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina HiSeq 2000 |
| |
|
| Data processing |
The raw reads were processed on the CLIPZ server (www.clipz.unibas.ch; Khorshid et al., Nucleic Acids Research 2011, 39:D245 (PMID 21087992)).
For subsequent analyses only uniquely mapped reads were considered.
Genome_build: hg19 Feb 2009
Supplementary_files_format_and_content: bed files with genomic coordinates of reads mapped; scores represent the number of reads
|
| |
|
| Submission date |
Jan 22, 2013 |
| Last update date |
May 15, 2019 |
| Contact name |
Andreas R Gruber |
| E-mail(s) |
agruber@tbi.univie.ac.at
|
| Organization name |
University of Basel
|
| Department |
Biozentrum
|
| Lab |
Zavolan
|
| Street address |
Klingelbergstrasse 50-70
|
| City |
Basel |
| ZIP/Postal code |
4056 |
| Country |
Switzerland |
| |
|
| Platform ID |
GPL11154 |
| Series (1) |
| GSE43666 |
Insights into snoRNA biogenesis and processing from PAR-CLIP of snoRNA core proteins and small RNA sequencing |
|
| Relations |
| SRA |
SRX218959 |
| BioSample |
SAMN01893947 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM1067864_ETHZ_BSSE_100427_BS-DSU-ATTILA_1234_613TBAAXX_7.bed.gz |
6.3 Mb |
(ftp)(http) |
BED |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
