|
Status |
Public on May 08, 2013 |
Title |
Ago2 IP-seq (asynchronous cells) |
Sample type |
SRA |
|
|
Source name |
HeLa
|
Organism |
Homo sapiens |
Characteristics |
cell line: HeLa antibody: monoclonal Ago2; 11A9 antibody vendor: From Gunter Meister; PMID:18430891 3' adaptor: 5' TGGAATTCTCGGGTGCCAAGG 3'
|
Growth protocol |
HEK293 and HeLa cells were routinely generated by replating every 3 d on T75 flasks (Falcon, 353133) in DMEM supplemented with 10% FCS.
|
Extracted molecule |
total RNA |
Extraction protocol |
PAR-CLIP samples were extracted following the PAR-CLIP method (Hafner et al. 2010; PMID: 20371350). For HEK293 small RNA-seq samples total RNA was extracted with TRI Reagent, radiolabeled and size-selected on a PAA gel. For HeLa Ago2-IP samples lysates were clarified and Ago2-RNA complexes isolated with an antibody, Ago2-associated RNA TRI Reagent-extracted, radiolabeled and size-selected on a PAA gel. PAR-CLIP library preparation as described in (Hafner et al. 2010; PMID: 20371350). Small RNA libraries for HEK293 cells were constructed as described in (Hafner et al. 2008; PMID: 18158127). For HeLa Ago2 IP-seq samples Ago2-associated RNAs were extracted and used to prepare cDNA libraries as described in (Hafner et al. 2008; PMID: 18158127).
|
|
|
Library strategy |
RNA-Seq |
Library source |
transcriptomic |
Library selection |
size fractionation |
Instrument model |
Illumina HiSeq 2000 |
|
|
Data processing |
The raw reads were processed on the CLIPZ server (www.clipz.unibas.ch; Khorshid et al., Nucleic Acids Research 2011, 39:D245 (PMID 21087992)). For subsequent analyses only uniquely mapped reads were considered. Genome_build: hg19 Feb 2009 Supplementary_files_format_and_content: bed files with genomic coordinates of reads mapped; scores represent the number of reads
|
|
|
Submission date |
Jan 22, 2013 |
Last update date |
May 15, 2019 |
Contact name |
Andreas R Gruber |
E-mail(s) |
agruber@tbi.univie.ac.at
|
Organization name |
University of Basel
|
Department |
Biozentrum
|
Lab |
Zavolan
|
Street address |
Klingelbergstrasse 50-70
|
City |
Basel |
ZIP/Postal code |
4056 |
Country |
Switzerland |
|
|
Platform ID |
GPL11154 |
Series (1) |
GSE43666 |
Insights into snoRNA biogenesis and processing from PAR-CLIP of snoRNA core proteins and small RNA sequencing |
|
Relations |
SRA |
SRX218964 |
BioSample |
SAMN01893952 |