|
| Status |
Public on May 21, 2013 |
| Title |
ORF1p replicate 2 |
| Sample type |
SRA |
| |
|
| Source name |
HEK293T
|
| Organism |
Homo sapiens |
| Characteristics |
cell line: HEK293T
|
| Treatment protocol |
The PAR-CLIP protocol was performed as described in Hafner et al. (Cell 2010, doi: 10.1016/j.cell.2010.03.009) with minor modification. HEK293T cells were transiently transfected with plasmid constructs and grown for 24 hours before adding 100 uM 4-SU and grown for another 12 hrs.
|
| Growth protocol |
HEK293T cells were maintained in a tissue culture incubator at 5% CO2, 370C in high glucose Dulbecco’s modified Eagle medium (DMEM) without pyruvate (Invitrogen) supplemented with 10% fetal bovine calf serum, 2 mM L-glutamine and 100U/ml Penicillin-Streptomycin.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
UV-irradiated cells were lysed, treated with RNAseT1, and the RNA-protein complex was immunoprecipitated with anti-FLAG agarose beads for 1 hour at 40C. RNA was labeled with gamma ATP and the crosslinked RNA-proteins were resolved in a SDS-PAGE gel. ORF1 and HuR RNA-protein complexes were cut from the gel.
Recovered RNA was converted into cDNA libraries using a small RNA cloning protocol described in Hafner et al (Methods, 2008, doi: 10.1016/j.ymeth.2007.09.009)
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
size fractionation |
| Instrument model |
Illumina HiSeq 2000 |
| |
|
| Description |
library strategy: PAR-CLIP
|
| Data processing |
Remove Adapter: cutadapt -a GATCTCGTATGCCGTCTTCTGCTTG in.fastq > out.fastq
Align to reference genome: bowtie2 -x <indexed reference> -U in.fastq -S out.sam --quiet -p 3 -D 15 -R 2 -L 20 -N 1 --rdg 20,20 --rfg 20,20
Convert SAM to BAM (samtools view -b)
Select all alignments with a T-to-C change relative to the top strand
Convert BAM to pileup (samtools mpileup)
Normalize pileup depth by number of aligned reads in sample
Convert mpileup output to wiggle (wig): http://genome.ucsc.edu/goldenPath/help/wiggle.html
Convert wiggle to bigWig (wigToBigWig)
Genome_build: GRCh37 (UCSC hg19)
Supplementary_files_format_and_content: aligned sequence depth in bigWig (.bw) format: http://genome.ucsc.edu/goldenPath/help/bigWig.html
|
| |
|
| Submission date |
Jan 28, 2013 |
| Last update date |
May 15, 2019 |
| Contact name |
Adam D Ewing |
| E-mail(s) |
adam.ewing@gmail.com
|
| Organization name |
Johns Hopkins University
|
| Department |
Genetic Medicine
|
| Lab |
Kazazian
|
| Street address |
733 N. Broadway, MRB 439
|
| City |
Baltimore |
| State/province |
MD |
| ZIP/Postal code |
21205 |
| Country |
USA |
| |
|
| Platform ID |
GPL11154 |
| Series (1) |
| GSE43801 |
Enrichment of processed pseudogene transcripts in L1-ribonucleoprotein particles |
|
| Relations |
| SRA |
SRX220098 |
| BioSample |
SAMN01906585 |
