|
|
GEO help: Mouse over screen elements for information. |
|
Status |
Public on May 21, 2013 |
Title |
HuR |
Sample type |
SRA |
|
|
Source name |
HEK293T
|
Organism |
Homo sapiens |
Characteristics |
cell line: HEK293T
|
Treatment protocol |
The PAR-CLIP protocol was performed as described in Hafner et al. (Cell 2010, doi: 10.1016/j.cell.2010.03.009) with minor modification. HEK293T cells were transiently transfected with plasmid constructs and grown for 24 hours before adding 100 uM 4-SU and grown for another 12 hrs.
|
Growth protocol |
HEK293T cells were maintained in a tissue culture incubator at 5% CO2, 370C in high glucose Dulbecco’s modified Eagle medium (DMEM) without pyruvate (Invitrogen) supplemented with 10% fetal bovine calf serum, 2 mM L-glutamine and 100U/ml Penicillin-Streptomycin.
|
Extracted molecule |
total RNA |
Extraction protocol |
UV-irradiated cells were lysed, treated with RNAseT1, and the RNA-protein complex was immunoprecipitated with anti-FLAG agarose beads for 1 hour at 40C. RNA was labeled with gamma ATP and the crosslinked RNA-proteins were resolved in a SDS-PAGE gel. ORF1 and HuR RNA-protein complexes were cut from the gel. Recovered RNA was converted into cDNA libraries using a small RNA cloning protocol described in Hafner et al (Methods, 2008, doi: 10.1016/j.ymeth.2007.09.009)
|
|
|
Library strategy |
RNA-Seq |
Library source |
transcriptomic |
Library selection |
size fractionation |
Instrument model |
Illumina HiSeq 2000 |
|
|
Data processing |
Remove Adapter: cutadapt -a GATCTCGTATGCCGTCTTCTGCTTG in.fastq > out.fastq Align to reference genome: bowtie2 -x <indexed reference> -U in.fastq -S out.sam --quiet -p 3 -D 15 -R 2 -L 20 -N 1 --rdg 20,20 --rfg 20,20 Convert SAM to BAM (samtools view -b) Select all alignments with a T-to-C change relative to the top strand Convert BAM to pileup (samtools mpileup) Normalize pileup depth by number of aligned reads in sample Convert mpileup output to wiggle (wig): http://genome.ucsc.edu/goldenPath/help/wiggle.html Convert wiggle to bigWig (wigToBigWig) Genome_build: GRCh37 (UCSC hg19) Supplementary_files_format_and_content: aligned sequence depth in bigWig (.bw) format: http://genome.ucsc.edu/goldenPath/help/bigWig.html
|
|
|
Submission date |
Jan 28, 2013 |
Last update date |
May 15, 2019 |
Contact name |
Adam D Ewing |
E-mail(s) |
adam.ewing@gmail.com
|
Organization name |
Johns Hopkins University
|
Department |
Genetic Medicine
|
Lab |
Kazazian
|
Street address |
733 N. Broadway, MRB 439
|
City |
Baltimore |
State/province |
MD |
ZIP/Postal code |
21205 |
Country |
USA |
|
|
Platform ID |
GPL11154 |
Series (1) |
GSE43801 |
Enrichment of processed pseudogene transcripts in L1-ribonucleoprotein particles |
|
Relations |
SRA |
SRX220099 |
BioSample |
SAMN01906586 |
Supplementary file |
Size |
Download |
File type/resource |
GSM1071443_HuR.hg19.basechange.pileup.normalized.bw |
510.7 Mb |
(ftp)(http) |
BW |
SRA Run Selector |
Raw data are available in SRA |
Processed data provided as supplementary file |
|
|
|
|
|