GEO Accession viewer

NCBI > GEO > Accession Display

Not logged in | Login

GEO help: Mouse over screen elements for information.

Sample GSM1120314

Query DataSets for GSM1120314

Status

Public on Dec 12, 2013

Title

polyA RNA sequencing of STL003 Small Bowel Cells; polyA-RNA-seq_STL003SB_r1a

Sample type

SRA

Source name

Small Intestine tissue; polyA-RNA-seq_STL003SB_r1a

Organism

Homo sapiens

Characteristics

sample common name: Small Intestine
sra sample accession: SRS306623
disease: None
biomaterial_provider: Shin Lin, Stanford University
biomaterial_type: Primary Tissue
tissue_type: Small Intestine
tissue_depot: N/A
collection_method: Autopsy
donor_id: STL003
donor_age: 34
donor_health_status: polysubstance abuse (NO diabetes, hypertension, coronary artery disease, cancer)
donor_sex: Male
donor_ethnicity: Caucasian
experiment_type: mRNA-Seq
extraction_protocol: Qiagen RNeasy mini kit, performed as per manufacturer's instructions
cdna_preparation_initial_rna_qnty: 4 µg
cdna_preparation_polya_rna/: Dynabeads oligo(dt)25 (Invitrogen)
cdna_preparation_fragmentation: PolyA RNA resuspended in 2x Superscript III buffer supplemented with 10 mM DTT was incubated at 94°C for 4 min
cdna_preparation_fragment_size_range: 200-250
cdna_preparation_first_strand_synthesis_enzyme: SuperScript III (Invitrogen)
cdna_preparation_first_strand_purification: Purification with RNAClean XP beads (Agencourt)
cdna_preparation_second_strand_synthesis_enzyme: DNA Polymerase I (E. coli) (New England Biolabs)
cdna_preparation_second_strand_synthesis_dntp_mix: dNTP mix made from 10 mM dATP, dCTP, dGTP, dUTP
cdna_preparation_purification: Purification with AMPure XP beads (Agencourt)
dna_preparation_adaptor: TruSeq Multiplexed Adapters (Illumina)
dna_preparation_adaptor_ligation_protocol: 16°C for 16 hours with T4 DNA ligase (New England Biolabs)
dna_preparation_post-ligation_fragment_size_selection: Two rounds of purification with AMPure XP beads (Agencourt)
dna_preparation_uracil_dna_glycosylase_digestion: One half of adapter-ligated cDNA digested with uracil DNA glycosylase (Enzymatics) and used for subsequent steps.
library_generation_pcr_polymerase_type: TruSeq PCR Master Mix (Illumina)
library_generation_pcr_thermocycling_program: 98°C 30 sec; 10 cycles of 98°C 10 sec, 60°C 30 sec, 72°C 30 sec; 72°C 10 min
library_generation_pcr_number_cycles: 10
library_generation_pcr_primer: TruSeq PCR Primer Cocktail (Illumina)
library_generation_pcr_product_isolation_protocol: Purification with AMPure XP beads (Agencourt)
extraction_protocol_mrna_enrichment: Dynabeads oligo(dt)25 protocol
rna_preparation_reverse_transcription_primer_sequence: Random hexamers
rna_preparation_reverse_transcription_protocol: First-strand Superscript III (Invitrogen) RT protocol. RNAClean XP purification of first strand product. Second-strand synthesis using dUTP-containing dNTPS and DNA Polymerase 1 (E. coli) (New England Biolabs)
library_generation_pcr_template: cDNA
library_generation_pcr_template_conc: 5 ng/µL
library_generation_pcr_f_primer_sequence: 5' AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATC 3'
library_generation_pcr_r_primer_sequence: 5' CAAGCAGAAGACGGCATACGAGAT 3'
library_generation_pcr_primer_conc: 200nM

Extracted molecule

total RNA

Extraction protocol

Library construction protocol: Four µg of total RNA was extracted from frozen cell pellets using the RNeasy Mini Kit (Qiagen, Valencia, CA). PolyA RNA was isolated from total RNA using Dynabeads oligo(dt)25 (Invitrogen). PolyA selected RNA was eluted in 2x Superscript III buffer supplemented with 10mM DTT and was fragmented by incubation at 94°C for 4 minutes. First-strand cDNA was synthesized with the following reaction composition: 0.5 µL random hexamer, 0.5 µL RNase Out, 1 µL DTT (100 mM), 0.5 µL dNTP (25 mM), 0.5 µL SuperScript III (20 µL final). The reaction was incubated at 25°C for 10 min then 50°C for 50 min. Single-stranded cDNA was isolated by purification with RNAClean XP beads (Beckman Coulter Genomics, Danvers, MA). The dUTP-containing second-strand was synthesized with the following reaction: 1.5 µL NEBuffer 2 (NEB), 1 µL dNTP mix (10 mM dATP, dCTP, dGTP, and dUTP), 0.2 µL RNase H, 1 µL DNA Polymerase I (E. coli) (New England Biolabs) (15 µL final). The reaction was incubated at 16°C for 2.5 hours. The dUTP-containing cDNA was isolated by purification with AMPure XP beads (Beckman Coulter Genomics, Danvers, MA). The dUTP-containing cDNA was then end repaired and a 3'A base was added. TruSeq adapters (Illumina, San Diego, CA) were ligated to the dUTP-containing cDNA at 16°C for 16 hours with T4 DNA ligase (New England Biolabs). Adapter-ligated cDNA was isolated by two rounds of purification with AMPure XP beads. The dUTP-containing strands were digested at 37°C for 30 min with uracil DNA glycosylase (Enzymatics). Adapter-ligated, single-stranded DNA molecules were enriched by 10 cycles of PCR with the following reaction composition: 5 µL TruSeq PCR Primer Cocktail (Illumina), 25 µL TruSeq PCR Master Mix (Illumina) (50 µL final). The thermocycling parameters were: 98°C 30 sec, then 10-15 cycles of 98°C 10 sec, 60°C 30 sec and 72°C 30 sec, ending with one 72°C 5 min step. The reaction products were purified using AMPure XP beads.

Library strategy

RNA-Seq

Library source

transcriptomic

Library selection

cDNA

Instrument model

Illumina HiSeq 2000

Description

sample_term_id: UBERON_0002108
assay_term_id: OBI_0001271
nucleic_acid_term_id: SO_0000871
Design description: polyA RNA sequencing of STL003 Small Bowel Cells
Library name: polyA-RNA-seq_STL003SB_r1a
EDACC Genboree Experiment Page:
http://genboree.org/java-bin/project.jsp?projectName=XML%20Submissions%2FUCSD%2FEXPERIMENT%2FEDACC.15454
EDACC Genboree Sample Page:
http://genboree.org/java-bin/project.jsp?projectName=XML%20Submissions%2FUCSD%2FSAMPLE%2FEDACC.11844
****************
For data usage terms and conditions, please refer to:
http://www.drugabuse.gov/funding/funding-opportunities/nih-common-fund/epigenomics-data-access-policies
****************

Data processing

Various levels of processed data files will be made available as this project proceeds.