|
|
GEO help: Mouse over screen elements for information. |
|
Status |
Public on Jun 25, 2013 |
Title |
LIN28B_PARCLIP |
Sample type |
SRA |
|
|
Source name |
HEK293 cell culture
|
Organism |
Homo sapiens |
Characteristics |
cell line: HEK293 cell line stably expresses: FLAG-LIN28B par-clip antibody: FLAG culture medium: DMEM
|
Extracted molecule |
total RNA |
Extraction protocol |
PAR-CLIP and small RNA cloning (Hafner et al. 2010 Cell 141, 129–141)
|
|
|
Library strategy |
RNA-Seq |
Library source |
transcriptomic |
Library selection |
cDNA |
Instrument model |
Illumina HiSeq 2000 |
|
|
Description |
PARCLIP RNA binding sites HEK293 cells stably express FLAG-tagged LIN28B, that may be induced by Tamoxifen.
|
Data processing |
Note: due to special 5p adapter, 2nts need to be removed at 5p of each read in libraries 4SU_1 and 4SU_2 prior to any processing Adapters were removed by customized script; clipped reads were aligned using BWA (version 0.5.8c) to spliced mature mRNAs (hg18); alignments were processed using samtools (version 0.1.8); clusters were generated based on pileup files and ranked based on G:A transitions and G deletions; overlapping clusters of 6SG and 4SU libraries were fused. 4SU barcodes: TCTCTGCTCGTATGCCGTCTTCTGCTTG for 4SU_1, TCTCGTATCGTATGCCGTCTTCTGCTTG for 4SU_2. 6SG barcode: TCTGGGATCGTATGCCGTCTTCTGCTTG. 4SU_CSD barcode: TCTCCATTCGTATGCCGTCTTCTGCTTG. 4SU_ZND: TCTTTTATCGTATGCCGTCTTCTGCTTG. Genome_build: hg18 Supplementary_files_format_and_content: The .bed file reports binding sites. Columns: chromosome, start_position, end_position, cluster_id, score, strand, crosslink_start, crosslink_end, nan, nan.
|
|
|
Submission date |
May 14, 2013 |
Last update date |
May 15, 2019 |
Contact name |
Robin Graf |
E-mail(s) |
robin.graf@mdc-berlin.de
|
Phone |
+493094062396
|
Organization name |
Max Delbrueck Center for Molecular Medicine
|
Department |
Immune Regulation and Cancer
|
Lab |
Klaus Rajewsky
|
Street address |
Robert Rössle Str. 10
|
City |
Berlin |
ZIP/Postal code |
13092 |
Country |
Germany |
|
|
Platform ID |
GPL11154 |
Series (1) |
GSE46908 |
Identification of LIN28-bound mRNAs reveals features of target recognition and regulation |
|
Relations |
BioSample |
SAMN02144020 |
SRA |
SRX277588 |
Supplementary file |
Size |
Download |
File type/resource |
GSM1140829_LIN28B_consensus_sites.bed.gz |
52.9 Kb |
(ftp)(http) |
BED |
SRA Run Selector |
Raw data are available in SRA |
Processed data provided as supplementary file |
|
|
|
|
|