GEO Accession viewer

NCBI > GEO > Accession Display

Not logged in | Login

GEO help: Mouse over screen elements for information.

Sample GSM1142270

Query DataSets for GSM1142270

Status

Public on Sep 02, 2017

Title

HDMYZ, 0 hour, 2

Sample type

SRA

Source name

HDMYZ, 0ug/ml Actinomycin D, 0 hour

Organism

Homo sapiens

Characteristics

cell line: HDMYZ
cell type: hodgkin's lymphoma
actinomycind treatment: 0ug/ml
time post treatment: 0 hour

Treatment protocol

HDMYZ cells were treated with 2ug/ml ActD for 0 (HDMYZ_0303, HDMYZ_0304), 4 (HDMYZ_4313) and 12 hours (HDMYZ_12311, HDMYZ_12312).

Growth protocol

HDMYZ cells were cultured in RPMI with 10% FBS and 1% Penicillin-Streptomycin.

Extracted molecule

total RNA

Extraction protocol

HDMYZ cells were collected with Trizol reagent (Invitrogen) following manufacturer's protocol. Small RNAs of 15-40 bases were gel-purified from 5 ug total RNA.
Small RNAs of 15-40 bases were gel-purified from 5 ug total RNA with 10% acrylamide gel (American Bioanalytical AB13021). Purified small RNA was subjected to library preparation, similar to Illumina protocol with modification. Briefly, pre-adenylated primer was made following a published protocol (Chen, Y.-R., Zheng, Y., Liu, B., Zhong, S., Giovannoni, J. and Fei, Z. (2012) A cost-effective method for Illumina small RNA-Seq library preparation using T4 RNA ligase 1 adenylated adapters. Plant Methods, 8, 41.) using /5Phos/TGGAATTCTCGGGTGCCAAGG/3ddC/. Small RNA was ligated to the pre-adenylated primer with truncated T4 RNA ligase 2 (NEB M0242S). The 35-55 bases product was purified with 10% acrylamide gel and further went through a 5? ligation reaction with primer: dGdTdTdCdAdGdAdGdTdTdCdTdAdCdA GUCCGACGAUC (Dharmacon) with T4 RNA ligase 1 (Fermentas EL0021). The 60-80 bases product was purified with 10% acrylamide gel and reverse transcribed with M-MLV reverse transcriptase (Invitrogen 28025-013) using primer: GCCTTGGCACCCGAGAATTCCA. The RT product was PCR amplified for 18 cycles with Phusion DNA polymerase (NEB M0530) using a universal primer: AATGATACGGCGACCACCGAGATCTACACGTT-CAGAGTTCTACAGTCCGA and a specific primer for each sample. 130-150nt small RNA libraries were purified with 8% acrylamide gel. Barcoded small RNA libraries were sequenced on a HiSeq2000 (Illumina).

Library strategy

RNA-Seq

Library source

transcriptomic

Library selection

size fractionation

Instrument model

Illumina HiSeq 2000

Data processing

Illumina Casava1.8.1 software used for basecalling.
Sequence reads were processed by miRDeep2 package, with the following modifications. First, to remove adaptor sequence, we removed both the main adaptor sequence present in the sequencing reads, as well as the second most abundant adaptor variant. In addition, we did not restrict the size of small RNAs during adaptor removal. Second, we used miRBase v18 for mapping the reads. Third, for quantifying miRNA and isoform frequency, we limited reads to more or equal to 15 bases in length with zero mis-match during mapping.
The total number of reads that were mapped to known mature miRNAs was used to normalize read frequencies for each miRNA or each miRNA isoform.
Genome_build: miRBase v18
Supplementary_files_format_and_content: The processed date file is tab-delimited format. Each row in the file indicates a miRNA isoform, each column indicates a kind of information for miRNA isoforms. The first column "Category" indicates the turnover pattern of miRNA isoforms. If left blank, indicates a slow turnover miRNA; "1" means an ultra-fast turnover miRNA whose level goes down more than 90% after 4 hours of ActD treatment; "2" means a fast turnover miRNA whose level goes down more than 50% after 12 hours of ActD treatment. The second column "Precursor" shows the miRNA precursor name for each miRNA isoform. The third column "Mature miRNA" shows the mature miRNA name for each miRNA isoform. The fourth column " Isoform sequence" shows the sequence for each miRNA isoform. The fifth to ninth column show the normalized read frequency for each sample. The tenth column shows the ratio between 4 hour sample versus the average of 0 hour samples. The eleventh column shows the ratio between the average of 12 hour samples versus the average of 0 hour samples. The twelfth column "Detectable" shows the detectability of each miRNA isoform: "1" indicates the average of normalized read frequency for 0 hour is larger than 0.000001; "0" indicates the average of normalized read frequency for 0 hour is less than 0.000001.

Submission date

May 15, 2013

Last update date

May 15, 2019

Contact name

Mei Zhong

E-mail(s)

mei.zhong@yale.edu

Phone

203-737-6203

Fax

203-785-4305