 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Jul 24, 2013 |
| Title |
Nanog_vp_Nanog_kd |
| Sample type |
SRA |
| |
|
| Source name |
ESC 129/Cast
|
| Organism |
Mus musculus |
| Characteristics |
cell type: ESC 129/Cast
barcode: AGGACGTAATTTTGGTAAGCTT
bait: Nanog
|
| Treatment protocol |
cells are cross linked using 2% formaldehyde for 10minutes at room temperature in 10%FCS/PBS
|
| Growth protocol |
Two independently derived mouse ES cell lines were used in this study: IB10 ESCs (129/Ola background) and 129/Cast ESCs (129SVJ/Casteneus background). IB10 ESCs were grown in BRL conditioned DMEM (high glucose, Gibco) supplemented with 15% FBS, 1X NEAA (Gibco), 1X Pen Strep (Gibco), 1:1000 β-mercaptoethanol (Invitrogen), 1X L-Glutamine (Gibco) and 1000 U/ml LIF (Gibco). 129/Cast ESCs were grown on irradiated mouse embryonic fibroblasts (MEFs) in DMEM supplemented with 15% FBS, 1x NEAA, 1x Pen Strep, 1:1000 β-mercaptoethanol and 1000 U/ml LIF. NP cells (IB10 and 129/Cast) were grown in DMEM-F12 supplemented with 1:100 N2 (Gibco), 20 ng/ml bFGF (Peprotech), 20 ng/ml murine EGF (Peprotech). For the 129/Cast NP cells 1X B-27 (Gibco) was added 10. We generated astrocytes by growing IB10 NP cells to confluency and washing twice with DMEM before adding astrocyte medium (DMEM-F12 supplemented with 1:100 N2 and 2% FBS) 19. The culture medium was changed twice and cells were grown for 5 days to make sure differentiation was complete, which was confirmed by immunofluorescence. NPCs were generated according to Conti and collogues (Conti et al. 2005) with slight modifications. In brief ES cells (129SVJ/CAST) were differentiated in N2B27 (StemCell Recourses) for 7 days, followed by the formation of neural spheres in N2B27 supplemented with EGF and FGF (10ng/ml). 3 day old spheres were allowed to attach to the culture dish to expand NPCs.(also see Splinter et al., 2011, Genes & Development).
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
The initial steps of the 4C procedure, as published before (Simonis et al., 2006, Nature Genetics), remain unchanged. Cells are cross linked using 2% formaldehyde for 10min at room temperature in PBS 10%FCS, nuclei are isolated, after which chromatin is digested with HindIII and subsequently ligated under diluted conditions. After reversal of the cross links the DNA is purified and treated with the second restriction enzyme treatment (indicated in the sample description). After a second re-ligation step the sample is purified and a 4C PCR is applied.
|
| |
|
| Library strategy |
OTHER |
| Library source |
genomic |
| Library selection |
other |
| Instrument model |
Illumina HiSeq 2000 |
| |
|
| Description |
4C PCR product
|
| Data processing |
The initial step in the 4C-seq analysis is the alignment of the sequencing reads to a reduced genome of sequences that flank HindIII sites (fragment ends), using custom perl scripts. Due to their ambiguous nature in reporting contacts, repetitive fragment ends were excluded from subsequent analysis. The reduced genome was based on mouse mm9.
Genome_build: mm9
|
| |
|
| Submission date |
Jul 02, 2013 |
| Last update date |
May 15, 2019 |
| Contact name |
Elzo de Wit |
| Phone |
+31 30 2121 800
|
| Organization name |
Hubrecht Institute
|
| Street address |
Uppsalalaan 8
|
| City |
Utrecht |
| ZIP/Postal code |
3584 CT |
| Country |
Netherlands |
| |
|
| Platform ID |
GPL13112 |
| Series (1) |
| GSE37275 |
The pluripotent genome in three dimensions is shaped around pluripotency factors |
|
| Relations |
| BioSample |
SAMN02222865 |
| SRA |
SRX317106 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM1179562_Nanog_vp_Nanog_kd.wig.gz |
326.7 Kb |
(ftp)(http) |
WIG |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
