 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Oct 04, 2014 |
| Title |
4Clong |
| Sample type |
SRA |
| |
|
| Source name |
HEK293T
|
| Organism |
Homo sapiens |
| Characteristics |
cell line: HEK293T
tissue: kidney
age: embryo
genotype: wild type
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
DNA samples were prepared as described before (Dekker et al., 2002; Osborne et al., 2004; http://www.protocol-online.org/cgi-bin/prot/view_cache.cgi?ID=3978).
Cross-linking
To suspension containing about 20x106 HEK293T cells in 40 ml of DMEM formaldehyde solution was added to final concentration 1.5%. After mixing incubation of cell suspension was performed for 10 min at room temperature with mixing. The quenching with 2.75 ml of 2M glycin (final concentration 0.125M) was performed. After incubation at room temperature for 5 min the suspension was cooled for 15 min in ice bath and then cells were collected by centrifugation for 15 min at 3500 rpm at +2°C.
Lysis
The pellet of cells was resuspended at °C in 1ml of buffer containing 10 mM tris-HCl buffer, pH 8, 10 mM NaCl, 0.2% NP-40 and freshly added protease inhibitors-- 0.1 mM PMSF and 1:500 protease inhibitor cocktail (Sigma). After incubation for 15 min cells were homogenized by passing through insulin syringe about 50 times into Eppendorf. Then nuclei were spin down by centrifugation for 5 min at 5000 rpm in Eppendorf centrifuge 5415 R at +2°C.
Digestion with EcoRI
The nuclei pellet was resuspended in 756 ul of solution containing 40 mM tris-HCl buffer, pH 7.4, 50 mM NaCl, 10 mM MgCl2 and 10 mM 2-mercaptoethanol. Then 20% SDS was added to final concentration 0.3% and incubation with shaking was performed for 1 h at +37°C. To sequester SDS 180 ul of 10% Triton X-100 was added and the incubation for 1 h at +37°C was performed. Before digestion 1 ul of BSA (5 mg/ml) was added with mixing. Then 50 ul of EcoRI (10 u/ul) was added and after mixing digestion was performed overnight at +37°C.
Ligation
To inactivate the restriction enzyme, 35'ul of 20% SDS was added (final concentration 0.7%) and the probe was heated to 65°C for 30 min. Then the mixture was transferred into 15 ml Nunc tube and consequently 375 ul of 20% Triton X-100 (to final concentration 1%), 750 ul of 10x ligase buffer, 7,5'ul of BSA (5 mg/ml), 80 ul of 100 mM ATP, and 5241 ul of milliQ water were added and the final 7.5 ml solution was well mixed. Then 10 ul of T4 DNA ligase (200 u/ul) was added and after mixing incubation was performed for 5 h at +16°C and then for 30 min at room temperature. Usually during ligation DNA concentration was equal to 2 ng/ul.
DNA purification
For isolation of DNA 50 ul of proteinase K (10 mg/ml) was added (final concentration 50 ug/ml) and after mixing incubation was performed at 55°C overnight. For RNA digestion 40 ul of RNase A (10 mg/ml) was added (final concentration 0.5 ug/ml) and after mixing incubation was performed for 30 min at +37°C. After extensive extraction with phenol-chloroform extraction (three times with 7 ml each) DNA was precipitated by 2.5 vol. of ethanol after addition of 40 ul 10 mg/ml glycogen and 175 ul 4M NaCl. The final DNA pellet was washed twice with 70% ethanol and then dissolved in 0.1xTE.
Digestion with FaeI
About 15 ug of DNA was digested in 250 ul solution with 75 u of FaeI overnight at +37°C. Then the enzyme was inactivated by heating at 65°C for 30 min. DNA was isolated after phenol-chloroform extraction, precipitated by ethanol and dissolved in 100 ul of 0.1xTE.
Ligation
For circularization 15'ug of DNA was incubated in 8 ml of T4 DNA ligase buffer containing 400 u of T4 DNA ligase for 5 h at +16°C. DNA was isolated after phenol-chloroform extraction, precipitated by ethanol and dissolved in 50 ul of 0.1xTE.
PCR and library preparation
One or two rounds of PCR were used as described below. There are about 300-400 copies of rDNA. That is why a single round of PCR (with up to 35 cycles) was found to be sufficient. DNA concentration was titrated and finally about 30 ng of DNA was used for PCR with primers 5' TCTTTGAAAAAAATCCCAGAAGTGGT 3' and 5' AAGTCCAGAAATCAACTCGCCAGT 3' (for PCR-1), and 5' GCCTAAGCCTGCTGAGAACTTTC 3' and 5' CAGCATTCTGTAGGGAGATCAAATC 3' (for PCR-2). After separation in 2% agarose gels two DNA fractions (200-400 bp and higher 400 bp) were eluted using QIAqiuck gel extraction kit (Quigen). The libraries were prepared using TruSeq RNA Sample Preparation Kit v2 (Illumina) using adapter AR006 for 200-400 bp DNA fraction and adapter R007 for DNA fraction higher 400 bp. The samples were sequenced using MiSeq (Illumina) following the manufacturer's protocols.
|
| |
|
| Library strategy |
ChIP-Seq |
| Library source |
genomic |
| Library selection |
ChIP |
| Instrument model |
Illumina MiSeq |
| |
|
| Description |
DNA fraction >400 bp
|
| Data processing |
Base calling and quality control were performed in real time with standard Illumina analysis pipeline using a phiX control.
Sequenced reads were trimmed for adaptor sequences and low quality sequences by cutadapt v. 1.2.1 using the following options: --minimum-length=30 --trimmed-only --quality-base=33 --quality-cutoff=3 -n 2 -g CTGGTGAGGGCATG -g GAATTCCCTGCTTCCCATT
Trimmed reads were mapped to rDNA and to hg19p10 by bwa 0.7.5a using the mem algorithm and by samtools 0.1.12a (r862)
Mapping and alignment results were converted to resulting table using ad hoc Perl scripts. Main results are in Text table files, bed files are supplied for more convenience.
Genome_build: Human ribosomal DNA complete repeating unit, GenBank Accession number U13369
Genome_build: Homo Sapiens hg19/GRCh37.p10 genome with included to chr14 from address 1 Human ribosomal DNA U13369
Supplementary_files_format_and_content: Tab-delimited text file include the following features of each mapping: begin, end, length, coverage, number of reads, sequence. BED files are supplied too.
|
| |
|
| Submission date |
Jul 25, 2013 |
| Last update date |
May 15, 2019 |
| Contact name |
Nickolai Tchurikov |
| E-mail(s) |
tchurikov@eimb.ru
|
| Organization name |
Engelhardt Institute of Molecular Biology
|
| Department |
Department of Epigenetic Mechanisms of Gene Expression Regulation
|
| Street address |
32, Vavilova str.
|
| City |
Moscow |
| ZIP/Postal code |
119991 |
| Country |
Russia |
| |
|
| Platform ID |
GPL15520 |
| Series (1) |
| GSE49193 |
Hot spots of DNA double-strand breaks and genomic contacts of human rDNA units are involved in epigenetic regulation [rDNA units] |
|
| Relations |
| BioSample |
SAMN02264591 |
| SRA |
SRX327640 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM1195267_table_hg19_sample2.bed.gz |
13.9 Kb |
(ftp)(http) |
BED |
| GSM1195267_table_hg19_sample2.txt.gz |
347.5 Kb |
(ftp)(http) |
TXT |
| GSM1195267_table_rDNA_sample2.bed.gz |
536 b |
(ftp)(http) |
BED |
| GSM1195267_table_rDNA_sample2.txt.gz |
2.0 Kb |
(ftp)(http) |
TXT |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
