|
| Status |
Public on Dec 05, 2013 |
| Title |
MCF7 profiling library 1 |
| Sample type |
SRA |
| |
|
| Source name |
MCF7 cell culture
|
| Organism |
Homo sapiens |
| Characteristics |
cell line: MCF7
purification: oligo(dT) beads
|
| Treatment protocol |
MCF-7 cells were grown in medium supplemented with 4-thiouridine at a final concentration of 200 microM for 16 hours. Cells were UV-crosslinked at 365 nm.
|
| Growth protocol |
MCF-7 cells were grown in D-MEM high glucose with 10% (v/v) fetal bovine serum, 1% (v/v) 2 mM L-glutamine, 1% (v/v) 10,000 U/ml penicillin/10,000 µg/ml streptomycin.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Eluted protein-RNA complexes were RNase I treated, followed by ammonium sulfate precipitation. Precipitate was separated by SDS-PAGE and transferred onto a nitrocellulose membrane. RNA was extracted from membrane by proteinase K treatment and phenol/chloroform extraction. Recovered RNA was dephosphorylated using CIP. After dephosphorylation RNA was phenol/chloroform extracted, ethanol precipitated and 50 end labeled with T4 PNK. Radiolabeled RNA was extracted and subsequent small RNA cloning and adaptor ligations were performed as described previously in small RNA cloning protocol (Hafner et al. 2008 Methods).
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
Illumina HiSeq 2000 |
| |
|
| Description |
ProtOccProf library 1
Binding Profile
barcode for 4SU_Library1_1.qfa: TCTCGTATCGTATGCCGTCTTCTGCTTG
barcode for 4SU_Library1_2.qfa: TCTCGTATCGTATGCCGTCTTCTGCTTG
|
| Data processing |
Read demultiplexing, read filtering and adapter trimming was done using flexbar (Dodt et al, 2012). Reads belonging to the same library were pooled.
Further read processing was performed using the Poppi pipeline. We used TopHat2 (version 2.06) (Trapnell et al., 2009 and Kim et al. 2013) for spliced alignment of strand-specific protein occupancy profiling reads to the human reference genome sequence (hg18).
We separated all reads by strand and generate two strand-specific mpileup read coverage files with samtools (version 0.1.18) (Li et al., 2009). These file are subsequently used to produce a separate bedgraph file for each strand (Watson / Crick). Additionally, a single bedgraph file for strand-specific T-C conversions is produced in a similar manner. T-C transitions sites are only included in the final file if at least two conversion events are observed on average.
Genome_build: hg18
Supplementary_files_format_and_content: bedGraph
|
| |
|
| Submission date |
Aug 13, 2013 |
| Last update date |
May 15, 2019 |
| Contact name |
Markus Landthaler |
| E-mail(s) |
markus.landthaler@mdc-berlin.de
|
| Phone |
+49-30-9406-3026
|
| Organization name |
Max-Delbrück-Center for Molecular Medicine
|
| Department |
Berlin Institute for Medical Systems Biology
|
| Street address |
Robert-Rössle-Straße 10
|
| City |
Berlin |
| ZIP/Postal code |
13125 |
| Country |
Germany |
| |
|
| Platform ID |
GPL11154 |
| Series (1) |
| GSE49831 |
Differential Protein Occupancy Profiling of the mRNA Transcriptome |
|
| Relations |
| BioSample |
SAMN02318734 |
| SRA |
SRX336156 |
