 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Dec 02, 2013 |
| Title |
TSS_RN2_2 |
| Sample type |
SRA |
| |
|
| Source name |
MLL-AF9/NrasG12D murine cell line
|
| Organism |
Mus musculus |
| Characteristics |
cell line: RN2
strain: C57BL/6
|
| Treatment protocol |
Murine AML cell lines RN2 cell line or shRNA transduced RN2 cell lines are used for 4C-seq experiments. Before crosslinking, RN2 cells transduced with indicated constructs were treated with 1ug/ml doxycycline to induce shRNA expression for 48h. TRMPV_Rluc is negative control shRNA targeting Renilla luciferase. In brief, cells were crosslinked using 1% formaldehyde for 20 min at room temperature.
|
| Growth protocol |
Murine AML cell line was cultured in RPMI1640 supplement with 10% FBS and penicillin/streptomycin
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
Isolated nuclei were digested for 4 hrs with 200U HindIII at 37°C, followed by overnight incubation with 400U HindIII, and a final 4hr incubation with 200U HindIII. Then, samples were ligated overnight in 7ml using 50U T4 DNA ligase (at 16°C. Ligation circles were phenol-chloroform extracted and ethanol precipitated with glycogen as a carrier. These were further digested with 50U of DpnII overnight at 37°C, followed by heat inactivation for 25 min at 65°C, and ligation in 14ml with 100U T4 DNA ligase at 16°C. These trimmed circles (4C template) were phenol-chloroform extracted and ethanol precipitated with glycogen as a carrier.
4C-seq library construction (Splinter et al. Nat Methods. 2012)
|
| |
|
| Library strategy |
OTHER |
| Library source |
genomic |
| Library selection |
other |
| Instrument model |
Illumina MiSeq |
| |
|
| Data processing |
Mapping of 4C data was performed using 4Cseqpipe, as described in (van de Werken et al. 2012). 4Cseqpipe analyzes 4C-seq experiments by including packages that allow sequence extraction, mapping, normalization, and plotting of cis-contact profiles around viewpoints. Custom restriction site tracks were built using the -build_re_db option of 4Cseqpipe for the mm8 mouse genomic version (UCSC) with HindIII and DpnII as first and second restriction cutters, respectively. A total of 3618110 PE 100x100 reads (2014321 rep1 + 1603789 rep2) were obtained for the MycTSS viewpoint experiments, and 3649354 PE 100x100 reads (2059310 rep1 + 1590044 rep2) for Enh3. Paired-end 2 reads from the first biological replicates were used for analysis in the 4Cseq pipeline as these contain the HindIII restriction site fragment. PE 2 reads were trimmed to a size of 53bp which include the 4C HindIII amplification primer in the beginning of the read (GCTTCCTTGCCTAAGACAAGCTT, 23bp) followed by 30bp of interacting sequence. These processed reads were mapped to the custom mm8 tracks with the in-built 4Cseqpipe mapper. Near-cis domainograms were generated for the whole chr15 for both viewpoints using the median stat_type and plotting the 80th quantile of the distribution of normalized contact intensities for 10Kb windows in MycTSS_4C and in Enh3_4C. These values were put into wig files for visualization using the UCSC genome browser mm8 version, where data range of the vertical axis was set to the ~7% and 8% of the maximal normalization value for MycTSS_4C and Enh3_4C, respectively, to deal with the fact that the majority of data are very close to the viewpoint.
2,958,300 PE 100x100 reads were obtained for Myc TSS shBrg1 (1465526 rep1 + 579006 rep2) and 4,860,980 (2430490 rep1 + 1400170 rep2) for Myc TSS Rluc viewpoints. For calculating the mean value of the 4C-seq data, P1+P2 (paired-end read 1 + 2) reads from replicate 1 of Brg1 and Rluc were mapped against the mm8 mouse genome using bowtie with max two mismatches and binned into 1kb windows for the whole sequence of chromosome 15. Total number of mapped reads were then normalized using rep1 TSS RN2 viewpoint read number as reference. Sliding windows of 10kb were made for chromosome 15. For each 10kb sliding window, the highest 1kb bin value in the window was substituted for the second highest value to avoid outlier bias for mean calculation.
Genome_build: mouse mm8
Supplementary_files_format_and_content: wig
|
| |
|
| Submission date |
Nov 20, 2013 |
| Last update date |
May 15, 2019 |
| Contact name |
Christopher R Vakoc |
| Organization name |
Cold Spring Harbor Lab
|
| Lab |
Vakoc Lab
|
| Street address |
1 Bungtown Rd
|
| City |
Cold Spring Harbor |
| State/province |
NY |
| ZIP/Postal code |
11724 |
| Country |
USA |
| |
|
| Platform ID |
GPL16417 |
| Series (2) |
| GSE52279 |
Role of SWI/SNF in acute leukemia maintenance and enhancer-mediated Myc regulation |
| GSE52595 |
Role of SWI/SNF in acute leukemia maintenance and enhancer-mediated Myc regulation (4C-seq) |
|
| Relations |
| Reanalyzed by |
GSE123131 |
| BioSample |
SAMN02419048 |
| SRA |
SRX381525 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM1272325_TSS_RN2_2_cisnorm_10kb.wig.gz |
265.1 Kb |
(ftp)(http) |
WIG |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
