NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM1299113 Query DataSets for GSM1299113
Status Public on Feb 17, 2016
Title HITS-CLIP_Ctrl_2
Sample type SRA
 
Source name control_brain
Organism Homo sapiens
Characteristics disease status: control
tissue: brain
tissue subtype: dorsolateral prefrontal cortex
Growth protocol Frozen brain tissue from control and advanced AD subjects was obtained from the Mount Sinai Brain Bank.
Extracted molecule total RNA
Extraction protocol Brain tissue was UV irradiated and subjected to nELAVL HITS-CLIP (detailed description in accompanying paper)
 
Library strategy RNA-Seq
Library source transcriptomic
Library selection cDNA
Instrument model Illumina Genome Analyzer IIx
 
Description control subject
Data processing library strategy: HITS-CLIP
filtering (min:0-4:20,mean:5-29:20)
collapsing of exact sequences
stripping of degenerate linker (5nt; ends with a G)
removal of 3'adaptor (GTGTCAGTCACTTCCAGCGG)
alignment with novoalign (unambigous mapping)
collapsing of PCR duplicates
Genome_build: hg18
Supplementary_files_format_and_content: bed file containing genomic coordinates of unique unambigously mapped reads
 
Submission date Dec 29, 2013
Last update date May 15, 2019
Contact name Claudia Scheckel
E-mail(s) claudia.scheckel@gmail.com
Organization name University Hospital Zurich
Department Institute of Neuropathology
Street address Schmelzbergstrasse 12
City Zurich
State/province NY
ZIP/Postal code 8091
Country Switzerland
 
Platform ID GPL10999
Series (2)
GSE53695 nELAVL HITS-CLIP in Alzheimer's Disease patients
GSE53699 nELAVL HITS-CLIP and RNA-seq in Alzheimer's Disease patients and IMR-32 neuroblastoma cells
Relations
BioSample SAMN02486962
SRA SRX400197

Supplementary file Size Download File type/resource
GSM1299113_g1_2_CLIP_bed.txt.gz 37.4 Mb (ftp)(http) TXT
SRA Run SelectorHelp
Raw data are available in SRA
Processed data provided as supplementary file

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap