|
Status |
Public on Apr 01, 2015 |
Title |
LB-01_Pso-NL_D |
Sample type |
SRA |
|
|
Source name |
human reticular dermis (RD)
|
Organism |
Homo sapiens |
Characteristics |
tissue: Dermis indication: Non-Lesional Psoriatic Skin
|
Extracted molecule |
total RNA |
Extraction protocol |
miRNEasy Micro Kit (Qiagen) A barcoded cDNA library for small RNA sequencing was prepared according to Hafner M. et al., Methods 44; 3-12, 2008 and Hafner M et al., Methods 58; 164-170, 2012.
|
|
|
Library strategy |
miRNA-Seq |
Library source |
transcriptomic |
Library selection |
size fractionation |
Instrument model |
Illumina HiSeq 2500 |
|
|
Description |
lane: Marianne_C_NoIndex_L002_R1_001.fastq.gz barcode + 3' adaptor: TAACGTCGTATGCCGTCTTCTGCTTG
|
Data processing |
Samples are demultiplexed by assigning by 5 nt barcodes and adapters and barcodes are removed from fastq files converted to fasta using perl scripts. Fasta file is collapsed into a non-redundant fasta file in which the read count is contained within the read header and mapped against an in-house ncRNA reference derived from GenBank and an internally curated set of miRNAs. BWA v0.5.9 used, with parameters aln -n 2 -t 16 -i 0 -d 0 to align reads to the reference. Multi-mapping reads are first assigned to hits with the lowest number of errors, then the count is split equally between the number of locations mapped. Genome_build: hg19 Supplementary_files_format_and_content: tab separated file summarizing reads attributed to an internal reference of ncRNAs. First column is the read, second is the count, last column a comma-separated list of mapped annotation
|
|
|
Submission date |
Apr 23, 2014 |
Last update date |
May 15, 2019 |
Contact name |
Miguel Brown |
E-mail(s) |
miguel.a.brown@gmail.com
|
Organization name |
The Rockefeller University
|
Street address |
1230 York Ave Box 186
|
City |
New York |
State/province |
New York |
ZIP/Postal code |
10065 |
Country |
USA |
|
|
Platform ID |
GPL16791 |
Series (1) |
GSE57012 |
Laser capture microdissection followed by next-generation sequencing identifies disease-related microRNAs in psoriatic skin that mirror the systemic psoriatic miRNome |
|
Relations |
BioSample |
SAMN02732359 |
SRA |
SRX525010 |