|
| Status |
Public on Aug 01, 2014 |
| Title |
L3 salivary glands Female small RNAs |
| Sample type |
SRA |
| |
|
| Source name |
L3 salivary glands Female
|
| Organism |
Drosophila melanogaster |
| Characteristics |
developmental stage: L3 Larvae
strain: Oregon-R (wild-type)
tissue: Salivary glands
Sex: Female
|
| Treatment protocol |
Tissues from wild-type flies were manually dissected in cold PBS to exclude contamination with other tissues, then quickly frozen in liquid nitrogen to preserve RNA integrity.
|
| Growth protocol |
Flies were reared on standard food at 24oC and staged according to regular procedures.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Total RNAs were prepared with Trizol reagent (Invitrogen). After 2S rRNA removal,18-30nt small RNAs were size selected on a 15% polyacrylamide, 7M urea gel.
Small RNA libraries were prepared according to Malone et al. Cold Spring Harb Protoc. 2012. In short, size selected RNAs are ligated with a 3' adaptor (Modban) with mutant T4 RNA ligase 2, truncated (home made) and ligated products extracted from a 15% polyacrylamide, 7M urea gel. A 5’ adaptor is then added with T4 RNA ligase (Ambion) and selected ligated products reverse transcribed with Superscript lll reverse transcriptase (Invitrogen). Amplification of the cDNA using Illumina primers results in a final library sequenced on an Illumina GAIIX platform.
|
| |
|
| Library strategy |
miRNA-Seq |
| Library source |
transcriptomic |
| Library selection |
size fractionation |
| Instrument model |
Illumina Genome Analyzer IIx |
| |
|
| Data processing |
The 3' linker (CTGTAGGCACCATCAATCGTATGCCGTCTTCTGCTTG) sequence is clipped from the sequenced reads with fastx-clipper.
Only reads with a minimum length of 16nt are kept for further processing.
Sequencing artifacts (reads with all but 3 identical bases) are filtered out.
Identical reads are collapsed with fastq_collapser; Reads sequence and count are provided in Read_Count_Table processed files.
Genome_build: dm3 BDGP release 5
Supplementary_files_format_and_content: Processed data text files contain processed Read_ID, processed Read_Sequence and Read_Count
|
| |
|
| Submission date |
Apr 23, 2014 |
| Last update date |
May 15, 2019 |
| Contact name |
Delphine Fagegaltier |
| Organization name |
Cold Spring Harbor Lab
|
| Department |
Genomics Division
|
| Lab |
Greg Hannon
|
| Street address |
One Bungtown Rd
|
| City |
Cold Spring Harbor |
| State/province |
NY |
| ZIP/Postal code |
11724 |
| Country |
USA |
| |
|
| Platform ID |
GPL11203 |
| Series (1) |
| GSE57029 |
Profiling and comparison of miRNA populations in male and female tissues from Drosophila melanogaster at various stages |
|
| Relations |
| BioSample |
SAMN02732478 |
| SRA |
SRX525268 |
