NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM1386322 Query DataSets for GSM1386322
Status Public on Mar 02, 2015
Title Time-course_Ago2_input_WT_24hr
Sample type SRA
 
Source name Primary hippocampal neurons
Organism Rattus norvegicus
Characteristics strain: Sprague Dawley
embryo stage for culture prep: E18.5
days of in vitro culture (div): DIV16
Treatment protocol Neurons were transduced with lentiviruses 9 days after plating (DIV9) at a multiplicity of infection (MOI) of 1-5, and analyzed 5-6 days after infection (DIV15-16). Immunoprecipitation of FLAG/HA-Ago2 was performed with Anti-FLAG M2 Magnetic Beads (Sigma. Cat # M8823).
Growth protocol Primary dissociated hippocampal neurons were routinely generated by removing hippocampi from embryonic day 18.5 (E18.5) rats and treated with 0.05 % trypsin (Sigma) for 15 min at 37 °C, followed by washing and trituration. Dissociated cells were plated at 30,000 cells/cm2 on poly-D-lysine coated plates (BD biosciences) and cultured in Neurobasal medium (Gibco) supplemented with 2 mM Glutamax (Invitrogen), and 2% B-27 supplement (Invitrogen).
Extracted molecule total RNA
Extraction protocol Total RNA and Ago-associated RNA (FLAG-IP fraction) were extracted using Trizol reagent.
Small RNA libraries were prepared for sequencing using Illumina TruSeq Small RNA Sample Prep Kits (Cat # RS-200-0024).
 
Library strategy miRNA-Seq
Library source transcriptomic
Library selection size fractionation
Instrument model Illumina HiSeq 2500
 
Data processing For each read, the 3′ adaptor TGGAATTCTCGGGTGCCAAGG was removed by aligning it to the read allowing one or two mismatches in prefix alignments of at least seven or ten bases, respectively. Reads with Low-complexity were filtered out based on their dinucleotide entropy (removing <1% of the reads). Only reads with a minimum length of 14nt were retained. Alignments to the rat miRNA database miRBase release 20 (http://www.mirbase.org/) were performed by the software bowtie (version 0.9.9.1) with parameters -v 2 -a -m 100, tracking up to 100 best alignment positions per query and allowing at most two mismatches. Reads that mapped to a miRNA but at the same time also mapped with fewer mismatches to the genome (rn4) were filtered out. The expression of each miRNA was determined by counting the number of associated reads. To compensate for differences in the read depths of the individual libraries, each sample was divided by its total number of counts and multiplied by the ave rage sample size. The resulting values were log2 transformed using a pseudocount of 8 (y=log2(x+8)). The two experiments “Syn-Target” and “Time-course” were normalized separately.
genome build: rn4 (UCSC)
Supplementary_files_format_and_content:MiRNA expression table (all samples)
 
Submission date May 14, 2014
Last update date May 15, 2019
Contact name Dimos Gaidatzis
E-mail(s) d.gaidatzis@fmi.ch
Organization name Friedrich Miescher Institute
Street address Maulbeerstrasse 66
City Basel
ZIP/Postal code 4058
Country Switzerland
 
Platform ID GPL18694
Series (1)
GSE57663 Target mRNAs induce tailing and trimming of Ago2-loaded miRNAs in neurons
Relations
SRA SRX542597
BioSample SAMN02777388

Supplementary data files not provided
SRA Run SelectorHelp
Processed data are available on Series record
Raw data are available in SRA

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap