|
Status |
Public on Nov 19, 2014 |
Title |
Del_SCR_129/Cast_1_p9 [Illumina MiSeq] |
Sample type |
SRA |
|
|
Source name |
embryonic stem cells
|
Organism |
Mus musculus |
Characteristics |
strain: 129/Cast genotype: ΔSCR(129/Cast), clone 1 passage: 9 after colony seletion
|
Treatment protocol |
SCR deleted clones contain a deletion of the Sox2 downstream enhancer which lies between Chr3:34653922-34661217 in the M. musculus genome build mm9. Deletions were generated in F1 ES cells using gRNA104 (TAGCATACGTCACGCCGGAA) and gRNA112 (ACTGTTCTCGAACACTCTGT) to target the Cas9 nuclease.
|
Growth protocol |
All cells were maintained on gelatin-coated plates in ES media supplemented with LIF and two inhibitors (2i, CHIR99021 and PD0325901).
|
Extracted molecule |
total RNA |
Extraction protocol |
RNA was isolated using Trizol (Life Technologies) and DNase treated prior to library construction. NEBNext mRNA Library Prep Reagent Set for Illumina
|
|
|
Library strategy |
RNA-Seq |
Library source |
transcriptomic |
Library selection |
cDNA |
Instrument model |
Illumina MiSeq |
|
|
Description |
Del_SCR_129Cast_1_p9.bedgraph Del_SCR_129Cast_1_p9(129).bedgraph Del_SCR_129Cast_1_p9(Cast).bedgraph
|
Data processing |
Variant sequence data was obtained from the Sanger Institute (http://www.sanger.ac.uk/resources/mouse/genomes/) on 14/02/2014 Reads were aligned to in silico constructed versions of the 129S1 and CastEiJ genomes using Tophat2 running Bowtie2. Mapped reads were split into 129, Cast or unknown using custom scripts and variant data, only variant bases sequenced with Phred score > 20 (on standard 33 offset) were considered for allele calling BedGraphs were generated using bedtools v2.17.0 genomecov script with standard settings. genome build:mm9
|
|
|
Submission date |
Jun 09, 2014 |
Last update date |
May 15, 2019 |
Contact name |
Jennifer Mitchell |
E-mail(s) |
ja.mitchell@utoronto.ca
|
Phone |
4169786711
|
Organization name |
University of Toronto
|
Department |
Cell and Systems Biology
|
Street address |
25 Harbord Street
|
City |
Toronto |
State/province |
Ontario |
ZIP/Postal code |
M5S 3G5 |
Country |
Canada |
|
|
Platform ID |
GPL16417 |
Series (1) |
GSE58339 |
A Sox2 distal enhancer cluster regulates embryonic stem cell differentiation potential |
|
Relations |
BioSample |
SAMN02848489 |
SRA |
SRX583671 |