 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Oct 01, 2014 |
| Title |
CIRS-seq (Not treated, Replicate #2) |
| Sample type |
SRA |
| |
|
| Source name |
Mouse embryonic stem cells
|
| Organism |
Mus musculus |
| Characteristics |
strain: 129/Ola
cell line: E14 mESC
treatment: none
|
| Treatment protocol |
Approximately 10^7 cells were harvested and lysed in 1ml of ice-cold Structure Buffer D (10mM Hepes-KOH pH 7.9, 100mM KCl, 10mM MgCl2, and 0.5% NP-40) for DMS probing, or Structure Buffer C (50mM Potassium Borate pH 8.0, 100mM KCl, 10mM MgCl2, and 0.5% NP-40) for CMCT probing, supplemented with 100U/ml RNAse Inhibitor (Ambion), 100U/ml RNAse OUT (Invitrogen), and 100U/ml Superase IN (Invitrogen). After lysis, the extract was treated with 100 μg/ml of Proteinase K (Sigma) for 15 minutes at 30°C, and reaction was stopped by adding 20 μl of Protease Inhibitor Cocktail (Sigma). Sample was then splitted in 5 x 200 μl aliquots. For DMS treatment, DMS (Sigma) was added to final concentrations of 0, 50, 100, 150, and 200mM to each aliquot, and samples were incubated at 30°C for 2 minutes with moderate shaking. For CMCT treatment, CMCT (Sigma) was added to final concentrations of 0, 10, 20, 25, and 50mM to each aliquot, and samples were incubated at 30°C for 20 minutes with moderate shaking.
|
| Growth protocol |
Mouse embryonic stem cells E14 were grown on 0.1% gelatin-coated plates and maintained in DMEM (4.5g/L D-Glucose), supplemented with 15% heat-inactivated FBS, 0.1mM NEAA, 1mM Sodium Pyruvate, 0.1mM 2-Mercaptoethanol, 25U/ml penicillin, 25 μg/ml streptomycin and 1,500U/ml LIF
|
| Extracted molecule |
total RNA |
| Extraction protocol |
DMS reaction was quenched by placing samples on ice and adding 0.7M final ice-cold 2-Mercaptoethanol and 1ml ice-cold TRIzol (Invitrogen). After chloroform addition and centrifugation, one volume of 100% ethanol was added to the upper aqueous phase, and sample was purified using RNEasy Mini Spin Columns (Qiagen) to allow complete removal of 2-Mercaptoethanol and DMS. CMCT reaction was stopped by addition of 1ml ice-cold TRIzol. Samples corresponding to 0mM DMS/CMCT (NT condition), were extracted in 1ml ice-cold TRIzol.
For CIRS-seq library preparation, we first prepared pools of each treatment. The DMS sample was obtained by pooling the 50-100-150-200mM treated conditions, while the CMCT sample was obtained by pooling the 10-20-25-50mM treated conditions (~1.25 μg each). The samples obtained by treating with 0mM DMS and 0mM CMCT were pooled in equal amounts (~2.5 μg each), and constituted the Not treated (NT) control. Ribosomal RNA was depleted using Ribo-Zero Gold Kit (Epicentre). One-third of each sample (corresponding approximately to 100ng of Ribo- RNA) was subjected to reverse transcription with random hexamers using SuperScript II Reverse Transcriptase (Invitrogen). Reverse transcription reaction was carried out in 1 hour at 42°C, followed by 10 minutes at 70°C to inactivate the reverse transcriptase. Template RNA was then degraded by adding 10U of Ribonuclease H (Ambion) and incubating for 20 minutes at 37°C. After ethanol precipitation of cDNA, an adapter modified with a 5’-P group and a 3’-C3 spacer, corresponding to the reverse complement of the standard Illumina TruSeq Small RNA 5’ adapter (RC5), was ligated to cDNA 3’-OH termini using 200U of CircLigase II for 4 hours at 68°C. This approach allowed us to keep the strand-specificity of the library, so that each read will start 1nt downstream of the RT stopping point. Then, to enable ligation of a 5’ adapter, cDNA was treated with T4 Polynucleotide Kinase (NEB) in T4 DNA Ligase Buffer (NEB) for 1 hour at 37°C. After ethanol precipitation cDNA was loaded on a TBE-Urea 5% PAGE gel. A gel slice corresponding to 70-200nt was cut and cDNA was recovered by passive diffusion into diffusion buffer (500mM Ammonium acetate, 1mM EDTA, 10mM Magnesium acetate, 0.1% SDS) for 16 hours at 37°C, followed by ethanol precipitation. cDNA 5’ termini was then ligated to a second adapter, corresponding to the reverse complement of the standard Illumina TruSeq Small RNA 3’ adapter (RC3), using 200U of CircLigase II for 4 hours at 68°C. Adapter-ligated cDNA was then subjected to 15-18 cycles of PCR using standard Illumina TruSeq primers. To remove adapter dimers, library was loaded on a 3% (w/v) TBE-Agarose gel, and slice corresponding to 150-300nt was cut and purified using NucleoSpin Gel and PCR Clean-up kit (Macherey-Nagel).
|
| |
|
| Library strategy |
OTHER |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
Illumina HiScanSQ |
| |
|
| Description |
library strategy: CIRS-seq
Ribo-depleted total RNA
|
| Data processing |
Transcriptome reference was built from ENSEMBL (release 65) and sequences were extracted from a modified mm9 assembly with annotated SNVs from mESC E14 cells (http://www.ncbi.nlm.nih.gov/pubmed/25004115). Supplementary analysis data/tools (transcripts annotations, sequences, Bowtie v1 index, IGV genome file) are available from: http://epigenetics.hugef-research.org/cirs.php. Raw counts BED6 files present 6 columns: 1. Official ENSEMBL ID (release 65), 2. Transcript's position (0-based), 3. Transcript's position + 1 (0-based), 4. ENSEMBL Gene Symbol, 5. RT-stops at this position, 6. Strand (+). Attached Wiggle files: 1. CIRS-seq_Reactivity_rep1.wig (Normalized reactivity for biological replicate #1), 2. CIRS-Seq_Reactivity_Combined.wig (Normalized reactivity for pooled biological replicates #1 and #2).
For reads mapping, we used a recently published mm9 reference genome assembly variant that incorporates E14 mESCs (PMID: 25004115). Prior to mapping, the reads quality was estimated using the FastQC tool v0.10.1 (http://www.bioinformatics.babraham.ac.uk/projects/fastqc/). The nucleotide positions with a quality score below 20 (Phred33 scale) were trimmed using the fastx_trimmer tool from the FASTX Toolkit (http://hannonlab.cshl.edu/fastx_toolkit/). After low-quality position trimming, the reads in which sequencing continued through the 3’ adapter sequence (TGGAATTCTCGGGTGCCAAGG) were subjected to adapter clipping using the fastx_clipper tool from the FASTX Toolkit, and the reads shorter than 35 nt were discarded. The reads were then subjected to two mapping rounds on the E14 mm9 genome reference. In the first round, the reads were mapped using Bowtie v1.0.0, allowing for a maximum of 2 mismatches in the seed and allowing multiple mappings (parameters: -n 2 -a -y --best). In the second round, the unmapped reads were truncated to 35 nucleotides and mapped again with the same parameters used in the first round, except for the maximum allowed number of mismatches that was reduced to 1 (parameters: -n 1 -a -y --best). For transcriptome analysis, the full Ensembl mouse gene annotation was downloaded from UCSC (http://genome.ucsc.edu/cgi-bin/hgTables, Table: ensGene) in the BED format, and the transcript sequences were extracted from the reference E14 genome using the fastaFromBed utility from the BEDTools v2.17.0 suite (http://code.google.com/p/bedtools/). Genome mappings corresponding to Ensembl annotated transcripts were extracted using custom Perl scripts, and converted to Ensembl transcriptome-based coordinates.
Genome_build: mm9
|
| |
|
| Submission date |
Aug 04, 2014 |
| Last update date |
May 15, 2019 |
| Contact name |
Francesco Neri |
| E-mail(s) |
francesco.neri@unito.it
|
| Organization name |
University of Torino
|
| Street address |
Via Nizza 52
|
| City |
Torino |
| State/province |
Italy |
| ZIP/Postal code |
10126 |
| Country |
Italy |
| |
|
| Platform ID |
GPL16173 |
| Series (1) |
| GSE54106 |
Genome-wide profiling of mouse RNA secondary structures reveals key features of the mammalian transcriptome |
|
| Relations |
| BioSample |
SAMN02951662 |
| SRA |
SRX669297 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM1464625_CIRS-seq_NT_rep2_rawcounts.bed.gz |
26.0 Mb |
(ftp)(http) |
BED |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
| Processed data are available on Series record |
|
|
|
|
 |
