|
| Status |
Public on Oct 30, 2014 |
| Title |
H3K27ac ChIP-seq in SKMNC 48hrs shGFP |
| Sample type |
SRA |
| |
|
| Source name |
SKMNC after 48 hrs shGFP
|
| Organism |
Homo sapiens |
| Characteristics |
cell line: Ewing sarcoma cell line SKMNC
treatment: shGFP
time: 48hrs
chip antibody: H3K27ac (Active Motif, 39133)
|
| Treatment protocol |
shRNAs from the RNAi Consortium were used for knockdown (pLKO.1 backbone): FLI1 (TRCN0000005322), GFP (GCAAGCTGACCCTGAAGTTCAT). EWS-FLI1 was expressed using a lentiviral vector (pLIV). Lentiviruses were produced using standard protocols. Briefly, lentiviral shRNA or expression plasmids were co-transfected with GAG/POL and VSV plasmids into 293T packaging cells using FugeneHD (Roche) to produce the virus. Viral supernatant was collected 72 hours after transfection and concentrated by ultracentrifugation.
|
| Growth protocol |
A673 and SKMNC Ewing sarcoma cell lines were grown in RPMI 1640 containing 10% FCS at 37°C with 5% CO2. Cells were maintained at a density between 5 x 10^5 cells/ml and 2 x 10^6 cells/ml and split every 3 – 4 days. Primary pediatric mesenchymal stem cells were cultured in IMDM containing 10% FCS and 10ng/ml PDGF-BB (Peprotec).
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
Chromatin from formaldehyde-fixed cells (3-10 x 10^6 cells per epitope) was fragmented to a size range of 200 - 700 bases with a Branson 250 Sonifier. Solubilized chromatin was immunoprecipitated with the indicated antibodies and Protein G-Dynabeads (Life Technologies). Immunoprecipitated DNA was extracted with the Mini-Elute PCR purification kit (Qiagen) after crosslink reversal, RNAse A and Proteinase K treatment.
ChIP DNA samples were used to generate Illumina sequencing libraries following standard protocols.
|
| |
|
| Library strategy |
ChIP-Seq |
| Library source |
genomic |
| Library selection |
ChIP |
| Instrument model |
Illumina HiSeq 2000 |
| |
|
| Description |
SKNMC.shGFP48.H3K27ac
|
| Data processing |
ChIP DNA and input controls were sequenced with the Hi-Seq Illumina Genome Analyzer.
ChIP-seq reads were aligned to the reference genome (hg19) using BWA or MAQ (http://maq.sourceforge.net/). Reads arising from plasmid DNA contamination were filtered for two libraries (SKNMC shFLI148.FLI1 and shFLI196.FLI1).
We extended aligned reads to 200 bp to approximate fragment sizes and derived 25-bp resolution density maps by counting the number of fragments overlapping each position with IGVtools. All density maps were normalized to 10M reads.
Genome_build: hg19
Supplementary_files_format_and_content: Wig files were generated in 25-bp step based on UCSC definition and converted into bigWig files using UCSC utilities.
|
| |
|
| Submission date |
Oct 01, 2014 |
| Last update date |
May 15, 2019 |
| Contact name |
Martin Aryee |
| E-mail(s) |
aryee.martin@mgh.harvard.edu
|
| Organization name |
Massachusetts General Hospital
|
| Department |
Pathology
|
| Street address |
149 13th Street
|
| City |
Charlestown |
| State/province |
MA |
| ZIP/Postal code |
02129 |
| Country |
USA |
| |
|
| Platform ID |
GPL11154 |
| Series (2) |
| GSE61944 |
Genome-wide chromatin analysis of Ewing sarcoma (ChIP-seq) |
| GSE61953 |
Genome-wide chromatin analysis of Ewing sarcoma |
|
| Relations |
| BioSample |
SAMN03085528 |
| SRA |
SRX718125 |
