|
Status |
Public on Oct 30, 2014 |
Title |
RNA-seq A673 shFLI1 48 hrs |
Sample type |
SRA |
|
|
Source name |
A673 cells
|
Organism |
Homo sapiens |
Characteristics |
cell line: Ewing sarcoma cell line A673 treatment: shFLI1 time: 48 hrs
|
Treatment protocol |
shRNAs from the RNAi Consortium were used for knockdown (pLKO.1): FLI1 (TRCN0000005322), GFP (GCAAGCTGACCCTGAAGTTCAT). Lentiviruses were produced using standard protocols. Briefly lentiviral shRNA plasmids were co-transfected with GAG/POL and VSV plasmids into 293T packaging cells using FugeneHD (Roche) to produce the virus. Viral supernatant was collected 72 hours after transfection and concentrated by ultracentrifugation using an SW41Ti rotor (Beckman Coulter) at 28,000 rpm for 120 min.
|
Growth protocol |
The human Ewing sarcoma cell lines A673 and SKMNC were grown in RPMI 1640 containing 10% FCS at 37°C with 5% CO2.
|
Extracted molecule |
total RNA |
Extraction protocol |
Total RNA was isolated using the RNeasy Kit (Qiagen). 5 ug of total RNA was used to isolate polyA mRNAs and construct Illumina sequencing libraries.
|
|
|
Library strategy |
RNA-Seq |
Library source |
transcriptomic |
Library selection |
cDNA |
Instrument model |
Illumina HiSeq 2000 |
|
|
Description |
A673.shFLI148.RNAseq
|
Data processing |
Paired end reads were aligned to the reference genome using Tophat 1.4.1 Cufflinks 2.1.0 was used to generate read counts for Refseq genes (GTF downloaded from UCSC on 2013-09-11) Genome_build: hg19 Supplementary_files_format_and_content: Read count tables generated by Cufflinks
|
|
|
Submission date |
Oct 01, 2014 |
Last update date |
May 15, 2019 |
Contact name |
Martin Aryee |
E-mail(s) |
aryee.martin@mgh.harvard.edu
|
Organization name |
Massachusetts General Hospital
|
Department |
Pathology
|
Street address |
149 13th Street
|
City |
Charlestown |
State/province |
MA |
ZIP/Postal code |
02129 |
Country |
USA |
|
|
Platform ID |
GPL11154 |
Series (2) |
GSE61950 |
Genome-wide chromatin analysis of Ewing sarcoma (RNA-seq) |
GSE61953 |
Genome-wide chromatin analysis of Ewing sarcoma |
|
Relations |
BioSample |
SAMN03085611 |
SRA |
SRX718182 |