|
| Status |
Public on Jul 16, 2015 |
| Title |
hIPSC-T_P10_MTG_Rep1_smallRNA |
| Sample type |
SRA |
| |
|
| Source name |
hIPSCs from reprogrammed hiF-T cells (hIPSC-T)
|
| Organism |
Homo sapiens |
| Characteristics |
passage (pre-reprogramming): 10
|
| Treatment protocol |
Reprogramming treatments were perfomed by doxycyclin administration to hiF-T cells in hiF media first and hES media (basal medium, 20% KSR, 8ng/ml) after. Reprogramming intermediates were collected by MEF depletion and eventual surface marker enrichment as needed. Refer to manuscript for detailed reprogramming and sampling procedures.
|
| Growth protocol |
Refer to the section Cell Culture and Reprogramming in the Supplemental Experimental Procedures of the related manuscript.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Total RNA, including the small RNA fraction, was obtained by organic extraction followed by miRNeasy purification (Qiagen).
RNA-Seq Illumina libraries for small RNA profiling were prepared from 1 ug of total RNA using the TruSeq Small RNA Sample Prep Kit (Illumina).
|
| |
|
| Library strategy |
ncRNA-Seq |
| Library source |
transcriptomic |
| Library selection |
size fractionation |
| Instrument model |
Illumina HiSeq 2500 |
| |
|
| Description |
Secondary iPSC
|
| Data processing |
Small RNA read were mapped to the human genome with TopHat 2.0.7 and Bowtie 2.1.0. Spliced alignment by TopHat was disabled by omitting the GENCODE annotation file and providing the -no-novel-juncs option, which forces all alignments to be unspliced. Sequencing adapters were clipped from the reads using fastx_clipper form the FASTX toolkit (http://hannonlab.cshl.edu/fastx_toolkit/), using the options "-a TGGAATTCTCGGGTGCCAATGAACTCCAG -l 18 -Q 33". Reads were mapped with TopHat, as opposed to Bowtie, because the resulting alignment files are properly formatted for direct input to Cuffdiff. Small RNA expression levels were estimated using Cuffdiff 2.2.0 by providing Cuffdiff with the small RNA records from the GENCODE annotation. The number of reads generated from each small RNA is directly proportional to abundance, and independent of small RNA length, so the option -no-length-correction was provided to Cuffdiff, disabling length-based normalization of read counts.
Genome_build: hg19
Supplementary_files_format_and_content: tab-delimited text files include normalized counts for each sample
|
| |
|
| Submission date |
Oct 28, 2014 |
| Last update date |
May 15, 2019 |
| Contact name |
Shannan J Ho Sui |
| E-mail(s) |
shosui@hsph.harvard.edu
|
| Organization name |
Harvard T.H. han Scholol of Public Health
|
| Department |
Biostatistics
|
| Street address |
655 Huntington Ave, Building 2, Rm 437A
|
| City |
Boston |
| State/province |
Massachusetts |
| ZIP/Postal code |
02115 |
| Country |
USA |
| |
|
| Platform ID |
GPL16791 |
| Series (2) |
| GSE62776 |
Integrative analyses of human reprogramming reveal dynamic nature of induced pluripotency [small RNA-Seq] |
| GSE62777 |
Integrative analyses of human reprogramming reveal dynamic nature of induced pluripotency |
|
| Relations |
| BioSample |
SAMN03145558 |
| SRA |
SRX745285 |
