GEO Accession viewer

NCBI > GEO > Accession Display

Not logged in | Login

GEO help: Mouse over screen elements for information.

Sample GSM1533993

Query DataSets for GSM1533993

Status

Public on Nov 02, 2014

Title

NE_rep24h_rep3_shRNA screen

Sample type

SRA

Source name

neural precursor cell: neuroepithelial

Organism

Homo sapiens

Characteristics

cell type: ES-derived neural progenitor cells
genetic background: HES5::eGFP BAC transgenic human ES cells (H9; WA-09; Wicell) expressing GFP under the HES5 promoter
treatment: Infected cells collected 24h after infection and puero selection

Growth protocol

Culturing undifferentiated human ES cells: HES5::eGFP BAC transgenic human ES cells (H9; WA-09; Wicell) expressing GFP under the HES5 promoter were cultured on mitotically inactivated mouse embryonic fibroblasts (MEFs) (Globalstem). Undifferentiated ES cells were maintained as described previously1 in medium containing DMEM/F12, 20% KSR, 1mM Glutamine, 1% Penicillin/Streptomycin, non essential amino acids and beta-mercaptoethanol. Undifferentiated ES cells were purified with pluripotency markers Tra-1-60 and PE-conjugated SSEA-3 (BD Pharmingen). Neural induction and long-term propagation of NPCs: Neural differentiation of ES cells was performed as described previously1-3. Briefly, neuroectodermal cells were generated either by monolayer induction – with dissociated ES cells plated on Matrigel (BD biosciences), or by co-culture on MS5 stromal cells. In both cases neural fate was directed by dual SMAD inhibition protocol2. Neural rosettes were harvested mechanically beginning on day 8-10 of differentiation. Rosettes were replated on culture dishes pre-coated with 15 μg/mL polyornithine (Sigma), 1 μg/mL Laminin (BD Biosciences) and 1ug/ml Fibronectin (BD Biosciences) (Po/Lam/FN) in N2 medium composed of DMEM/F12 and N2 supplement (Invitrogen). N2 supplement contained Insulin, Apo-transferin, Sodium Selenite, Putrecine and Progesterone. This medium was supplemented with SHH (200 ng/mL), FGF8 (100 ng/mL) and BDNF (20 ng/mL) (all from R&D Systems) to maintain early anterior regionalization of the neural plate. These factors were gradually replaced by FGF2 (20 ng/mL) and EGF (20 ng/mL) in the following two weeks of differentiation in order to maintain a proliferative (FGF and EGF responsive) NPC state. NPCs from all stages were collected at indicated days and FACS purified for HES5::GFP (NE to L-RG) or EGFR for LNPs to purify for the highest NPC state for each stage. Neuroectodermal cells were collected at day 12 of differentiation, Neuroepithelial/early radial glial cells were collected at day 14, mid neurogenesis radial glial cells were collected at day 35, late gliogenic radial glial cells were collected at day 80, and long term NPCs were collected at day 220. At each stage cells were either split for the next passage or subjected to FACS purification for HES5::GFP as described. Cells were replated onto Po/Lam/FN culture dishes. For neuronal, astroglial or oligodendroglial differentiation, NPCs were seeded at high density and subjected to differentiated for 17 days in the presence of AA/BDNF, 5% Fetal Bovine Serum (FBS) (Invitrogen), or AA/BDNF/SHH/FGF8, respectively. For more details, please see Edri et al.3.

Extracted molecule

genomic DNA

Extraction protocol

shRNA screen: We selected 244 transcription factors and epigenetic modifiers that were differentially or continuously highly expressed during our in vitro differentiation time course in an otherwise unbiased fashion (Extended Data Table 4). In addition, we included GFP, RFP, lacZ and luciferase as internal controls. We then obtained a sub-pool of the human 45K shRNA pool6 distributed by the Broad Institute Genomic Perturbations Platform and the RNAi Consortium (TRC) against these genes. For each gene, 5 distinct shRNAs were included as well as 5 scrambled and 3 empty control vectors, amounting to a total of 1230+8 shRNAs. The plasmid for shRNA expression under the control of the constitutive U6 shRNA promoter was the lentiviral vector pLKO.1. shRNA pool production and infection conditions were performed as previously described6. Subsequently, we performed calibration experiments to determine to optimal combination of MOI and Puromyocin concentration to ensure efficient selection. We identified MOI 0.4 and 1ug/ml of Puromycin as optimal parameters for all stages. We then infected 26 million cells at each stage of NE, ERG and MRG to ensure sufficient shRNA integration events to recover the complexity of the shRNA library. 24h post infection and prior to full expression but after integration of the lentivirus into the genome we collected 3 million cells to determine our baseline shRNA library representation. Subsequently, we subjected the cells to 5 days of Puromycin selection and then FACS sorted the resulting populations into HES5+ and HES5- compartments.
We assessed the representation of the shRNA library in each of the 9 populations by retrieving all shRNA integration events from genomic DNA isolated from each sample using PCR followed by next generation sequencing as previously described (Strezoska, Z. et al 2012). More specifically, we performed two rounds of PCR using the following primers for the primary PCR: Primary R :CTTTAGTTTGTATGTCTGTTGCTATTAT; Primary F: AATGGACTATCATATGCTTACCGTAAC. For the second, nested PCR we used: Nested F: GGCTTTATATATCTTGTGGAAAGGA; Nested R: GGATGAATACTGCCATTTGTCTC.

Library strategy

OTHER

Library source

genomic

Library selection

other

Instrument model

Illumina HiSeq 2500

Description

Protocol: shRNA screen
Processed data file: shRNAScreen_rawCounts.txt

Data processing

For the shRNA screen data analysis, we followed the protocol outlined by Dai et al. 2014 employing the R package limma. First, we extracted and counted the number of times each shRNA was observed in each library using the shRNA sequence as barcode and the R function processHairpinReads().
Supplementary_files_format_and_content: text file with raw counts for hairpin sequences

Submission date

Oct 29, 2014

Last update date

May 15, 2019

Contact name

Michael Johannes Ziller

Organization name

Max Planck Institute of Psychiatry

Department

Translational Psychiatry

Lab

Ziller lab