 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Sep 08, 2015 |
| Title |
RN2 Ren.713 24h JQ1 200 nM |
| Sample type |
SRA |
| |
|
| Source name |
Cell line
|
| Organism |
Mus musculus |
| Characteristics |
shRNA: Ren.713
treatment: 24h JQ1 200 nM
diagnosis: Leukemia
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Cells were harvested, flash frozen on dry ice, and RNA was extracted using RLT plus buffer (Qiagen) reagent.
RNA libraries were prepared for sequencing using standard Illumina protocols
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina HiSeq 2000 |
| |
|
| Description |
Sample 3
processed_data file: mouse_KD_counts.tsv
processed_data file: mouse_KD_RPKMs.tsv
|
| Data processing |
The paired-end and single-read fragments were trimmed on their 5' end (6 cycles PE100, 2 cycles SR50 NEB RNA sample prep protocol)
Adaptors were removed using cutadapt v1.4.2 and reads with a length of less than 18bp in any read of the pair were discarded. (Read1: cutadapt --match-read-wildcards -O 4 -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC, Read2: cutadapt --match-read-wildcards -O 4 -a AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCAT)
The trimmed and adaptor free reads were aligned against rDNA of the respective organism using bowtie2 v2.0.2 for paired-end and bowtie v0.12.5 for single-end reads. (100PE: bowtie2 (v2.0.2) --sensitive-local, 50SR: bowtie v0.12.5 -v 3 -k 1 --tryhard --chunkmbs 256)
The rRNA cleaned paired-end reads were aligned against the transcriptome to estimate the fragment size and the standard deviation of the fragment size using bwa v0.6.2. ( -N 1 -n 1 -a 1000)
The rRNA cleaned reads were aligned to the genome with the TopHat splice junction mapper for RNA-Seq reads using splice junction guidance of a GTF annotation file (mouse: mm10, RefSeq from UCSC, 2012/5/23, human: hg19, RefSeq 2012/11/30) (--segment-mismatches 1 --max-multihits 20 --library-type fr-firststrand --initial-read-mismatches 2, 100PE: --segment-length 25 --mate-inner-dist value from transcriptome alignment --mate-std-dev value from transcriptome alignment; SR50: --segment-length 24)
The uniquely aligning reads were used for counting per gene with htseq-count v 0.6.1p with the overlap-resolution mode option set to 'union' using the processed RefSeq-annotated gene database (supplementary files refseq.hg19.2014_0110.imp.merged.uniq.exons.fulltable.gtf and refseq.mm10.2014_3006.imp.merged.uniq.exons.fulltable.gtf)
genome build: hg19 / mm10
processed data files format and content: Tab-delimited text files containing raw counts and RPKMs for given samples
|
| |
|
| Submission date |
Dec 02, 2014 |
| Last update date |
May 15, 2019 |
| Contact name |
Philipp Rathert |
| E-mail(s) |
philipp.rathert@ibtb.uni-stuttgart.de
|
| Organization name |
University Stuttgart
|
| Department |
Biochemistry
|
| Street address |
Allmandring 31
|
| City |
Stuttgart |
| State/province |
Germany |
| ZIP/Postal code |
70569 |
| Country |
Germany |
| |
|
| Platform ID |
GPL13112 |
| Series (1) |
| GSE63782 |
Transcriptional plasticity promotes primary and acquired resistance to BET bromodomain inhibition |
|
| Relations |
| BioSample |
SAMN03248090 |
| SRA |
SRX793175 |
| Supplementary data files not provided |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data are available on Series record |
|
|
|
|
 |
