|
|
GEO help: Mouse over screen elements for information. |
|
Status |
Public on Jul 03, 2015 |
Title |
CD34_PBSC_DNAse-Seq |
Sample type |
SRA |
|
|
Source name |
CD34+ PBSC from donor
|
Organism |
Homo sapiens |
Characteristics |
dnasei origin: Worthington
|
Treatment protocol |
To perform DNaseI accessibility assays with patient and donor samples, the optimal cell number and DNaseI (DPFF DNaseI, Worthington Biochemical Corporation) concentration was titrated for each sample. The DNA digestion extent was comparable in all the generated samples as measured by RT-PCR (5). Briefly, nuclei were isolated from 1-5 x 106 cells by detergent lysis and immediately digested for 3 min at 22 °C with DNaseI at 1-10 U/ml in a 1 mM CaCl2 supplemented buffer. Nuclear proteins were digested with 1 mg/ml Proteinase K overnight at 37 °C
|
Growth protocol |
Patient and donor samples were obtained either from blood or bone marrow. Lymphoprep extraction of leukocytes was performed following 30 min no brake centrifugation. Enrichment for CD34 and CD117 were checked via FACS analysis. For CD14 samples, enricment for CD14 was controlled by FACS analysis. Where available, purification was performed using MACS columns following anti-CD34 bead conjugation to samples (anti-CD14 for CD14 samles).
|
Extracted molecule |
genomic DNA |
Extraction protocol |
Phenol-chloroform Libraries of DNA fragments from chromatin immunoprecipitation or DNase I treatment were prepared from approximately 10 ng of DNA. Firstly, overhangs were repaired by treatment of sample material with T4 DNA polymerase, T4 PNK and Klenow DNA polymerase (all enzymes obtained from New England Biolabs UK) in a reaction also containing 50 mM Tris-HCl,10 mM MgCl2, 10 mM Dithiothreitol, 0.4 mM dNTPs and 1 mM ATP. Samples were purified after each step using Qiagen MinElute columns (according to the manufacturer’s guidelines). Adenosine bases were added to 3’ ends of fragments using Klenow Fragment (3´- 5´ exo-minus), allowing for subsequent ligation of adapter oligonucleotides (Illumina part #1000521) using Quick T4 DNA ligase. After a further column clean up to remove excess adaptors, fragments were amplified in an 18 cycle PCR reaction using adapter-specific primers (sequences 5’- CAAGCAGAAGACGGCATACGAGCTCTTCCGATC*T and 5’-AATGATACGGCGACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATC*T). The libraries were purified and adapter dimers removed by running PCR products on 2% agarose gels and excising gel slices corresponding to fragments approximately 200-300 bp in size, which were then extracted using the Qiagen gel extraction kit. Libraries were validated using quantitative PCR for known targets, and quality assessed by running 1 μl each sample on an Agilent Technologies 2100 Bioanalyser. Once prepared, DNA libraries were subject to massively parallel DNA sequencing on an Illumina Genome Analyzer. ETO, RUNX1, C/EBPα, PU.1, LMO2 ChIP and Kasumi-1 DNase I libraries were sequenced employing the Illumina Genome Analyzer GAIIx, by using 36 base pair single end reads.
|
|
|
Library strategy |
DNase-Hypersensitivity |
Library source |
genomic |
Library selection |
DNAse |
Instrument model |
Illumina HiSeq 2000 |
|
|
Data processing |
Base-calling (Illumina) DNAse-seq reads were aligned to the hg18 genome assembly using Bowtie 1.00 to SAM output using --all --best --strata --v 2 -m 1 -S Fragments were extended using an R pipeline described in Koch, Fenouil, Gut et al. Nat Struct Mol Biol 2011. Fixed-step 10bp wig files were generated using an R pipeline described in Koch, Fenouil, Gut et al. Nat Struct Mol Biol 2011 Peaks were called using CoCAS (Benoukraf et al. Bioinformatics 2009) Genome_build: hg18 Supplementary_files_format_and_content: Fragments were extended using an R pipeline described in Koch, Fenouil, Gut et al. Nat Struct Mol Biol 2011. Fixed-step 10bp wig files were generated using an R pipeline described in Koch, Fenouil, Gut et al. Nat Struct Mol Biol 2011. Peaks were called using CoCAS (Benoukraf et al. Bioinformatics 2009)
|
|
|
Submission date |
Jan 12, 2015 |
Last update date |
May 15, 2019 |
Contact name |
Pierre Daniel Cauchy |
E-mail(s) |
cauchy@ie-freiburg.mpg.de
|
Phone |
+49 (0)761 270-77576
|
Organization name |
University Medical Center Freiburg
|
Department |
Zentrum für Translationale Zellforschung
|
Lab |
AG Onco-Immunology
|
Street address |
Breisacher Str. 115
|
City |
Freiburg |
State/province |
Baden-Württemberg |
ZIP/Postal code |
79106 |
Country |
Germany |
|
|
Platform ID |
GPL11154 |
Series (2) |
GSE64864 |
Chronic growth factor signaling in Acute Myeloid Leukemia is connected to a specific chromatin signature [DNAse-Seq] |
GSE64874 |
Chronic growth factor signaling in Acute Myeloid Leukemia is connected to a specific chromatin signature |
|
Relations |
BioSample |
SAMN03281251 |
SRA |
SRX838174 |
Supplementary file |
Size |
Download |
File type/resource |
GSM1581820_J209_5636_hg18_Human_J209-CD34-normal_s_8_sequence_merged.gff_146bp_elongated_ordered_bin10.wig.gz |
130.6 Mb |
(ftp)(http) |
WIG |
SRA Run Selector |
Raw data are available in SRA |
Processed data provided as supplementary file |
|
|
|
|
|