|
|
GEO help: Mouse over screen elements for information. |
|
Status |
Public on Aug 27, 2015 |
Title |
HESC Protected PARG MiSeq |
Sample type |
SRA |
|
|
Source name |
HESC Protected PARG MiSeq
|
Organism |
Homo sapiens |
Characteristics |
cell line: HS181
|
Treatment protocol |
BglII-digested chromatin from formaldehyde-fixed HESCs and EBs was used for preparation of 4C samples in the presence of protease inhibitors, as has been described earlier. The removal of PAR was performed by incubating the crosslinked chromatin with 25ng/ml (final concentration) recombinant PARG (Trevigen) in the presence of 2 mM DTT and 4mM vanadyl-ribonucleoside (final concentration; New England Biolabs) in Bgl II restriction buffer at 25°C for one day and two weeks at 37°C. To assess influence by any contaminating RNAse during this time period, boiled RNAse A (0.8 mg/ml) was added to parallel samples for the same period of time. The amplification of the interacting samples from the H19 ICR bait, which is enriched in repeats, necessitated the use of multiple, nested primers to reduce the presence of bait sequences as follows: F1 core: cgatgt tag tcgcat gag tgtcta t; R1 core: cat ggg tat ttctggaggctt ct; (94°C -3min, 4 x (98°C -20 sec, 70°C -20min, 68°C -20min); 25 x (98°C -20sec, 70°C -1.5 min, 68°C -20 min)); F2: gat tag gctcccagccatgcatg;R2: gggtcatctgggaat agg acactc (94°C -3 min, 27 x (98°C -20 sec, 58°C -1.5 min, 68°C -20 min)); F3: gataagagcgaaactctgtc; R3:cactcatgggagccgcac (94°C -3 min, 26 x (98°C -20 sec, 56°C -1 min, 68°C -20 min)); F4: cagaaa att atgacaatgaaag; R3: cactcatgggagccgcac (94°C -3 min, 23 x (98°C -20 sec, 59.5°C -30 sec, 68°C -20 min)).
|
Growth protocol |
The HESC line HS181 (Hovatta et al., 2003) was cultured as described previously (Imreh et al., 2004). In brief: cells were kept at 37°C, 6.8% CO2, high humidity, in HESC medium (=80% KO DMEM + 20% SR + 2 mM L-glutamine + 1% non-essential amino acids + 0.1 mM β-mercapoethanol + 4 ng/ml bFGF). For feeder cells, human foreskin fibroblasts (hFS) (CRL-2429) were cultured in Iscove's Medium + 10% FCS, irradiated with 35 Gy and seeded at a concentration of 2.1 × 104 cells/cm2. The HS181 cells were dissociated using Dispase enzyme (10 mg/ml) and mild mechanical splitting. Embryoid bodies (EBs) were produced using Dispase and kept in HESC medium without bFGF for 12 days in Petri dishes.
|
Extracted molecule |
genomic DNA |
Extraction protocol |
Standard Sollexa preparation. Library preparation for MiSeq sequencing: Nextera XT DNA sample preparation kit (FC-131-10244C) and Nextera XT index kit (FC-131-1001) were used to generate the libraries of 4C samples prepared from HESCs crosslinked in the presence or absence of Olaparib. Paired end sequencing with long read length (150 bp × 2) was performed on Illumina Miseq according to the instructions using MiSeq reagent kit v2 (MS-102-2001, Illumina).
|
|
|
Library strategy |
OTHER |
Library source |
genomic |
Library selection |
other |
Instrument model |
Illumina MiSeq |
|
|
Data processing |
Data processing of reads: Reads mapping to the bait, or to the Illumina adapters was masked using a customized script and BLAT. The masked libraries were subsequently mapped to a Bgl II-“digested” version of the GRCh37-based reference genome using BWA v.0.7.9a. The number of reads with MapQ greater than 10 was recorded for each BglII fragment in each library using custom Python scripts. Additional checks were performed to ensure that the fragments do not overlap blacklisted regions (Duke Excluded and DAC Blacklisted Regions).
Reference genome used in mapping: GRCh37.71 was downloaded from Ensembl. Each chromosome (1...22, X, Y, MT) was digested with BglII. Each BglII fragment is stored in the resulting fasta reference as a separate entry as chromo_bglII-start_bglII-end (i.e.: chr11_51323245_51328383). Additionally, both K12 Ecoli (NC_000913.2) and PhiX (NC_001422.1) were added to the reference to capture the PhiX sequencing spike-in control and contamination traces from Ecoli DNA, which is used in different experiments.
Genome_build: human NCBI genome build 37
Supplementary_files_format_and_content: tab-delimited text files for each Sample include interactors and bridges, and their corresponding read count.
|
|
|
Submission date |
Jan 21, 2015 |
Last update date |
May 15, 2019 |
Contact name |
Anita Göndör |
Organization name |
Karolinska Institutet
|
Department |
MTC
|
Lab |
Anita Göndör group
|
Street address |
Nobels väg 16, KI Solna Campus, Karolinska Institutet, Box 280
|
City |
Stockholm |
ZIP/Postal code |
171 77 |
Country |
Sweden |
|
|
Platform ID |
GPL15520 |
Series (1) |
GSE26880 |
PARP1- and CTCF-mediated interactions between active and repressed chromatin at the lamina promote oscillating transcription |
|
Relations |
BioSample |
SAMN03289744 |
SRA |
SRX849336 |
Supplementary file |
Size |
Download |
File type/resource |
GSM1588224_4C034_MID06_interactors.txt.gz |
4.1 Kb |
(ftp)(http) |
TXT |
SRA Run Selector |
Processed data provided as supplementary file |
Raw data are available in SRA |
|
|
|
|
|