|
| Status |
Public on Oct 15, 2015 |
| Title |
A549_glu_neg_rep1 |
| Sample type |
SRA |
| |
|
| Source name |
A549 cell line_without_glucose
|
| Organism |
Homo sapiens |
| Characteristics |
cell line: A549
tissue: lung carcinoma
|
| Treatment protocol |
A549 cells were cultured in the presence (25 mM) or absence of glucose for 48 hours prior to RNA extraction.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
not provided
For cDNA synthesis, custom oligo-dT primers were used with a barcode and adapter-linker sequence (CCTACACGACGCTCTTCCGATCT—XXXXXXXX-T15). After first strand synthesis, samples were pooled together based on Actb qPCR values, and RNA-DNA hybrids degraded using consecutive acid-alkali treatment. A second sequencing linker (AGATCGGAAGAGCACACGTCTG) was ligated using T4 ligase (NEB) followed by SPRI clean-up. The mixture was then PCR enriched for 12 cycles and SPRI purified to yield final strand specific RNA-seq libraries as previously described (Jha et al., 2015)
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina HiSeq 2500 |
| |
|
| Description |
3'end DGE
|
| Data processing |
Data were sequenced on HiSeq 2500 instrument (Illumina, San Diego, CA) using 41bpX18bp paired-end sequencing. Second mate was used for sample demultiplexing, at which point individual single-end fastqs were aligned to hg19 genome using STAR with following options --outFilterMultimapNmax 15 --outFilterMismatchNmax 6 --outReadsUnmapped Fastx --outSAMstrandField All. Gene expression was obtained using in-house scripts based on MACS and HTSeq (https://github.com/ctlab/quant3p).
Genome_build: hg19
Supplementary_files_format_and_content: tab delimited file that includes raw count data for each sample with NCBI Gene ID numbers in the first column.
|
| |
|
| Submission date |
Mar 05, 2015 |
| Last update date |
May 15, 2019 |
| Contact name |
Maxim N. Artyomov |
| E-mail(s) |
martyomov@pathology.wustl.edu
|
| Organization name |
Washington University in St.Louis
|
| Department |
Immunology&Pathology
|
| Street address |
660 S. Euclid Avenue, Campus Box 8118
|
| City |
St.Louis |
| State/province |
MO |
| ZIP/Postal code |
63110 |
| Country |
USA |
| |
|
| Platform ID |
GPL16791 |
| Series (1) |
| GSE66556 |
Mitochondrial phosphoenolpyruvate carboxykinase (PCK2) regulates metabolic adaptation and glucose-independent tumor cell growth |
|
| Relations |
| BioSample |
SAMN03389339 |
| SRA |
SRX900963 |
