 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Jul 01, 2015 |
| Title |
lympho-pelleted |
| Sample type |
SRA |
| |
|
| Source name |
Lymphocytes
|
| Organism |
Homo sapiens |
| Characteristics |
sample type: With ribosome purification
cell type: Lymphocytes
|
| Treatment protocol |
-
|
| Growth protocol |
RPMI + 15% FBS, 37C, 5% CO2
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Cells lysed in 200 mM KOAC, 15 mM MgCl, 15 mM K-HEPES pH 7.2, 180 uM cycloheximide. Treated with 10 ug/ml Mnase for 30 min
NEB Directional Small RNA kit. Libraries purified by gel electrophoresis
|
| |
|
| Library strategy |
OTHER |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
Illumina HiSeq 2500 |
| |
|
| Data processing |
Cutadapt
Trim AAGATCGGAAGAGCACACGTCT
cutadapt -a AAGATCGGAAGAGCACACGTCT --discard-untrimmed -m 20 DBA37-P.fastq -o trimDBA37-P.fastq
cutadapt 1.6 with Python 2.7.6
Bowtie
bowtie -p 7 -v 0 --norc database/chosenTranscripts reads/trimDBA37-P.fastq mapped/DBA37-P.map
Bowtie 1.1.1
Genome_build: NCBI v37
Supplementary_files_format_and_content: XLSX; RPKM values for all genes within the coding sequence
|
| |
|
| Submission date |
Apr 17, 2015 |
| Last update date |
May 15, 2019 |
| Contact name |
David Reid |
| Organization name |
Duke University
|
| Department |
Biochemistry
|
| Lab |
Nicchitta
|
| Street address |
436 Nanaline Duke Bldg., Box 3709 DUMC
|
| City |
Durham |
| State/province |
NC |
| ZIP/Postal code |
27710 |
| Country |
USA |
| |
|
| Platform ID |
GPL16791 |
| Series (1) |
| GSE68008 |
Methods comparison for ribosome profiling |
|
| Relations |
| BioSample |
SAMN03490543 |
| SRA |
SRX998838 |
| Supplementary data files not provided |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data are available on Series record |
|
|
|
|
 |
