 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on May 28, 2015 |
| Title |
Smc1_ChIAPET_rep2 |
| Sample type |
SRA |
| |
|
| Source name |
T-ALL
|
| Organism |
Homo sapiens |
| Characteristics |
cell type: Jurkat
chip antibody: SMC1
antibody catalog number: Bethyl A300-055A
|
| Growth protocol |
Human Jurkat cells were purchased from the American Type Culture Collection (ATCC), Manassas, VA. Cells were maintained under typical conditions in RPMI media with 10% Bovine Calf Serum. For location analysis, cells were grown to a density of 1 million per ml and 99% viability prior to cross-linked with formaldehyde for 10 min.
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
Whole cell extracts were sonicated to solubilize the chromatin. The chromatin extracts containing DNA fragments with an average size of 300-700 bp were immunoprecipitated using SMC1 antibody. Immunoprecipitated DNA was end-repaired, A-tailed, and proximity ligation was performed in the presence of a bridge-linker sequence. Unligated DNA was digested with exonuclease treatment followed by RNAse A, and Proteinase K treatment. DNA was then phenol:chloroform:isoamyl alcohol preciptated and subjected to library preperation.
Purified immunoprecipitated DNA were prepared for sequencing according to the Illumina Nextera Tagmentation protocol. Tagmented DNA was subjected to 12 cycles of LM-PCR using oligos provided by Illumina. Amplified fragments between 300 and 500bp (representing shear fragments between 200 and 400 nt in length and ~100bp of primer sequence) were isolated by agarose gel electrophoresis and purified.
|
| |
|
| Library strategy |
OTHER |
| Library source |
genomic |
| Library selection |
other |
| Instrument model |
Illumina HiSeq 2500 |
| |
|
| Description |
ChIA-PET against Smc1 in Jurkat T-ALL cells
|
| Data processing |
Library strategy: ChIA-PET
Images analysis and base calling was done using the solexa pipeline.
Reads were examined for the presence of at least 10 base pairs of linker. Reads that did not contain linker were not processed further. Reads containing linker were trimmed using cutadapt (cutadapt -m 17 -a forward=ACGCGATATCTTATCTGACT -a reverse=AGTCAGATAAGATATCGCGT --overlap 10).
Trimmed mate pairs were mapped independently to hg19 using bowtie version 1.1.1 (bowtie -e 70 -k 1 -m 1 -v 2 -p 4 --best --strata –S)
Aligned reads were paired with mates using read identifiers and, to remove PCR bias artifacts, were filtered for redundancy: PETs with identical genomic coordinates and strand information at both ends were collapsed into a single PET. The PETs were further categorized into intrachromosomal PETs, where the two ends of a PET were on the same chromosome, and interchromosomal PETs, where the two ends were on different chromosomes. The end read positions of all non-chimeric PETs were used to call PET peaks that represent local enrichment of the PET.
To identify long-range chromatin interactions, we first removed intra- chromosomal PETs of length < 5 kb because these PETs may originate from self-ligation of DNA ends from a single chromatin fragment in the ChIA-PET procedure. We next identified PETs that overlapped with PET peaks at both ends by at least 1bp. Operationally, these PETs were defined as putative interactions. Applying a statistical model based upon the hypergeometric distribution identified high-confidence interactions, representing high-confidence physical linking between the PET peaks. Specifically, the numbers of PET sequences that overlapped with PET peaks at both ends as well as the number of PETs within PET peaks at each end were counted. The PET count between two PET peaks represented the frequency of the chromatin interaction between the two genomic locations. A hypergeometric distribution was used to determine the probability of seeing at least the observed number of PETs linking the two PET peaks. A background distribution of interaction frequencies was then obtained through the random shuffling of the links between two ends of PETs, and a cutoff threshold for calling significant interactions was set to the corresponding p-value of the most significant proportion of shuffled interactions (at an FDR of 0.01). This method yielded similar number of interactions as the correction of p-values by the Benjamini-Hochberg procedure to control for multiple hypothesis testing. Operationally, the pairs of interacting sites with three independent PETs were defined as high-confidence interactions in the SMC1 ChIA-PET merged dataset and with two independent PETs in the individual SMC1 ChIA-PET replicates.
Genome_build: hg19
Supplementary_files_format_and_content: BED12 files: For each replicate the PET sequences were categorized into intrachromosomal PETs, where the two ends of a PET were on the same chromosome, and interchromosomal PETs, where the two ends were on different chromosomes. The unique intrachromosomal PETs are parsed into BED12 format file and high-confidence interactions were identified (N=2, FDR = 0.01 for each replicate; N=3, FDR=0.01 for merged)
|
| |
|
| Submission date |
May 18, 2015 |
| Last update date |
May 15, 2019 |
| Contact name |
Richard A Young |
| E-mail(s) |
young_computation@wi.mit.edu
|
| Phone |
617-258-5219
|
| Organization name |
Whitehead Institute for Biomedical Research
|
| Lab |
Young Lab
|
| Street address |
9 Cambridge Center
|
| City |
Cambridge |
| State/province |
MA |
| ZIP/Postal code |
02142 |
| Country |
USA |
| |
|
| Platform ID |
GPL16791 |
| Series (2) |
| GSE68977 |
Activation of proto-oncogenes by disruption of chromosome neighborhoods [chIA-PET] |
| GSE68978 |
Activation of proto-oncogenes by disruption of chromosome neighborhoods |
|
| Relations |
| BioSample |
SAMN03700054 |
| SRA |
SRX1030326 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM1689154_rep2_filtered_PET_interactionSummary_n2FDR0.01_intrachromosomal.bed12.gz |
943.3 Kb |
(ftp)(http) |
BED12 |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
| Processed data are available on Series record |
|
|
|
|
 |
