![](/coreweb/template1/pix/main_left_bg.gif) |
![](/coreweb/template1/pix/pixel.gif) |
GEO help: Mouse over screen elements for information. |
|
Status |
Public on Jul 03, 2015 |
Title |
MV4/11_STAT5_ChIP-Seq |
Sample type |
SRA |
|
|
Source name |
FLT3-ITD AML cell line
|
Organism |
Homo sapiens |
Characteristics |
antibody: anti-Stat5 antibody manufacturer and catalog number: Santa Cruz Biotechnology; sc-835 cell type: AML cell line: MV-4-11
|
Treatment protocol |
Cells were resuspended in 10 ml of growing medium, and cross-linked with 1% formaldehyde (Pierce) for 10 min at RT. The cross-linking reaction was stopped by adding glycine to a final concentration of 0.4 M, followed by two washes with ice–cold PBS. Cells were resuspended in 10 ml of ice-cold ChIP buffer A (10 mM HEPES pH 8.0, 10 mM EDTA, 0.5 mM EGTA, 0.25% Triton X-100, proteinase inhibitor cocktail (Roche UK, Burgess Hill, UK) and 0.1 mM PMSF), incubated for 10 min at 4°C with rotation, and centrifuged 5 min at 500 x g at 4 °C. The pellet was resuspended in 10 ml of ice–cold ChIP buffer B (10 mM HEPES pH 8.0, 200 mM NaCl, 1 mM EDTA, 0.5 mM EGTA, 0.01% Triton X-100, protease inhibitor cocktail and 0.1 mM PMSF), incubated for 10 min at 4 °C with rotation and centrifuged for 5 min at 500 x g at 4 °C. Cells were resuspended in 600 μl of ice-cold ChIP lysis buffer (25 mM Tris-HCl pH 8.0, 150 mM NaCl, 2 mM EDTA, 1% Triton X-100, 0.25% SDS, protease inhibitor cocktail and 0.1 mM PMSF), incubated 10 min on ice and sonicated at 5 °C using a Bioruptor™ (Diagenode, Liege, Belgium) to generate fragments an average length of 400-500 bp (10 min with 30 s “ON” and “OFF” cycles, power setting high). The lysates were centrifuged for 5 min at 16,000 x g at 4 °C and the supernatants were diluted with two volumes of ice-cold ChIP dilution buffer (25 mM Tris-HCl pH 8.0, 150 mM NaCl, 2 mM EDTA, 1% Triton X-100, 7.5% glycerol, protease inhibitor cocktail and 0.1 mM PMSF). For each IP, 15 μl of Dynabeads® protein G were pre–incubated with 50 μg BSA and 2 μg antibody against RUNX1 (Abcam, ab23980) for 2 h at 4 °C with rotation. The blocked antibody-bound protein G mix was added to 20–25 μg chromatin in a total volume of 500 μl diluted ChIP lysis buffer and incubated for 2 h at 4°C with rotation. After magnetic separation the beads were washed once with 1 ml wash buffer 1 (20 mM Tris-HCl pH 8.0, 150 mM NaCl, 2 mM EDTA, 1% Triton X-100, 0.1% SDS), twice with 1 ml wash buffer 2 (20 mM Tris-HCl pH 8.0, 500 mM NaCl, 2 mM EDTA, 1% Triton X-100, 0.1% SDS), once with 1 ml LiCl buffer (10 mM Tris-HCl pH 8.0, 250 mM LiCl, 1 mM EDTA, 0.5% NP-40, 0.5% Na-deoxycholate) and twice with 1 ml TE/NaCl buffer (10 mM Tris-HCl pH 8.0, 50 mM NaCl, 1 mM EDTA). For each wash the beads were mixed with ice-cold washing buffers for 10 min at 4 °C. The immunoprecipitated DNA was eluted two times with 50 μl ChIP elution buffer (100 mM NaHCO3, 1% SDS) for 15 min at RT with shaking. At this step the input control (1% of the starting material) was included in the experimental procedure after first adjusting the final volume to 100 μl with ChIP elution buffer. The eluted DNA was incubated overnight at 65 °C in the presence of 50 μg proteinase K. The DNA was finally purified using Agencourt AMPure (Beckman Coulter) magnetic beads according to the manufacturer’s instructions, eluted with 50 μl x TE.
|
Growth protocol |
Patient and donor samples were obtained either from blood or bone marrow. Lymphoprep extraction of leukocytes was performed following 30 min no brake centrifugation. Enrichment for CD34 and CD117 were checked via FACS analysis. For CD14 samples, enricment for CD14 was controlled by FACS analysis. Where available, purification was performed using MACS columns following anti-CD34 bead conjugation to samples (anti-CD14 for CD14 samles).
|
Extracted molecule |
genomic DNA |
Extraction protocol |
Phenol-chloroform Libraries of DNA fragments from chromatin immunoprecipitation or DNase I treatment were prepared from approximately 10 ng of DNA. Firstly, overhangs were repaired by treatment of sample material with T4 DNA polymerase, T4 PNK and Klenow DNA polymerase (all enzymes obtained from New England Biolabs UK) in a reaction also containing 50 mM Tris-HCl,10 mM MgCl2, 10 mM Dithiothreitol, 0.4 mM dNTPs and 1 mM ATP. Samples were purified after each step using Qiagen MinElute columns (according to the manufacturer’s guidelines). Adenosine bases were added to 3’ ends of fragments using Klenow Fragment (3´- 5´ exo-minus), allowing for subsequent ligation of adapter oligonucleotides (Illumina part #1000521) using Quick T4 DNA ligase. After a further column clean up to remove excess adaptors, fragments were amplified in an 18 cycle PCR reaction using adapter-specific primers (sequences 5’- CAAGCAGAAGACGGCATACGAGCTCTTCCGATC*T and 5’-AATGATACGGCGACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATC*T). The libraries were purified and adapter dimers removed by running PCR products on 2% agarose gels and excising gel slices corresponding to fragments approximately 200-300 bp in size, which were then extracted using the Qiagen gel extraction kit. Libraries were validated using quantitative PCR for known targets, and quality assessed by running 1 μl each sample on an Agilent Technologies 2100 Bioanalyser. Once prepared, DNA libraries were subject to massively parallel DNA sequencing on an Illumina Genome Analyzer.
|
|
|
Library strategy |
ChIP-Seq |
Library source |
genomic |
Library selection |
ChIP |
Instrument model |
Illumina HiSeq 2000 |
|
|
Data processing |
Base-calling (Illumina) DNAse-seq reads were aligned to the hg18 genome assembly using Bowtie 1.00 to SAM output using --all --best --strata --v 2 -m 1 -S Fragments were extended using an R pipeline described in Koch, Fenouil, Gut et al. Nat Struct Mol Biol 2011. Fixed-step 10bp wig files were generated using an R pipeline described in Koch, Fenouil, Gut et al. Nat Struct Mol Biol 2011 Peaks were called using CoCAS (Benoukraf et al. Bioinformatics 2009) Genome_build: hg18 Supplementary_files_format_and_content: Fragments were extended using an R pipeline described in Koch, Fenouil, Gut et al. Nat Struct Mol Biol 2011. Fixed-step 10bp wig files were generated using an R pipeline described in Koch, Fenouil, Gut et al. Nat Struct Mol Biol 2011. Peaks were called using CoCAS (Benoukraf et al. Bioinformatics 2009)
|
|
|
Submission date |
May 19, 2015 |
Last update date |
May 15, 2019 |
Contact name |
Pierre Daniel Cauchy |
E-mail(s) |
cauchy@ie-freiburg.mpg.de
|
Phone |
+49 (0)761 270-77576
|
Organization name |
University Medical Center Freiburg
|
Department |
Zentrum für Translationale Zellforschung
|
Lab |
AG Onco-Immunology
|
Street address |
Breisacher Str. 115
|
City |
Freiburg |
State/province |
Baden-Württemberg |
ZIP/Postal code |
79106 |
Country |
Germany |
|
|
Platform ID |
GPL11154 |
Series (1) |
GSE64862 |
Chronic growth factor signaling in Acute Myeloid Leukemia is connected to a specific chromatin signature [ChIP-Seq] |
|
Relations |
BioSample |
SAMN03701623 |
SRA |
SRX1032967 |
Supplementary file |
Size |
Download |
File type/resource |
GSM1690576_STAT5_MV411a_CGATGT_L001_R1_001_hg18_treat_afterfiting_all.wig.gz |
165.7 Mb |
(ftp)(http) |
WIG |
SRA Run Selector![Help](/coreweb/images/long_help4.gif) |
Raw data are available in SRA |
Processed data provided as supplementary file |
|
|
|
|
![](/coreweb/template1/pix/main_right_bg.gif) |