 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Jul 30, 2015 |
| Title |
SA876 |
| Sample type |
SRA |
| |
|
| Source name |
WM3682 melanoma cell line on DLL1 coated plate
|
| Organism |
Homo sapiens |
| Characteristics |
cell type: Melanoma
cell line: WM3682
|
| Treatment protocol |
WM3682 melanoma cells were cultured on DLL coated plates for 5 days.
|
| Growth protocol |
WM3682 melanoma cells were routinely grown in DMEN mediom.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Total RNA was extracted using TRIZOL according to manufacturer's instructions
TruSeq Small RNA Library Preparation Kits (Illumina) according to manufacturer's instructions
|
| |
|
| Library strategy |
miRNA-Seq |
| Library source |
transcriptomic |
| Library selection |
size fractionation |
| Instrument model |
Illumina HiSeq 2500 |
| |
|
| Data processing |
Sequencing and base calling: Illumina HiSeq 2500, SR 50bp, bcl2fastq version 1.8.3.
Trimming and filtering: position 51st was removed with the FASTX package (v0.0.14), the 5' and 3' ends were quality trimmed with a threshold of 32 over a silding window of 5 bases and a step size of 1 (in house perl scripts), adapter sequences were removed with Trim Galore (version 0.3.7), using TGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC<index>ATCTCGTATGCCGTCTTCTGCTTG as the adapter sequence (index changes for each sample) and discarding reads that became shorter than 15 bases, remaining reads were filtered with the FASTX package (v0.0.14), using a quality threshold of 20 over at least 90 percent of the read.
Alignment and counting: miRExpress (v1.0.0). Reads were mapped to the human pre-miRNAs in the miRBase database (release 21), with alignment identity threshold of 93 percect, assignment to a mature miRNA was done with an overlap of at least half the length, allowing a shift in position relative to the pre-miRNA of up to 11 bases, giving raw counts for each mature miRNA.
Differential expression: DESeq (v1.18.0)
Genome_build: miRBase, release 21
Supplementary_files_format_and_content: Tab-delimited, first row is a header line, contains 3 columns, first column is the miRNA name in the format “pre-miRNA,mature-miRNA”, second column is raw counts, third column is normalized counts.
|
| |
|
| Submission date |
May 31, 2015 |
| Last update date |
May 15, 2019 |
| Contact name |
Carmit Levy |
| E-mail(s) |
carmitlevy@post.tau.ac.il
|
| Organization name |
Tel Aviv University
|
| Department |
Human Genetics and Biochemistry
|
| Lab |
Sackler School of Medicine
|
| Street address |
Ramat Aviv
|
| City |
Tel Aviv |
| ZIP/Postal code |
69978 |
| Country |
Israel |
| |
|
| Platform ID |
GPL16791 |
| Series (1) |
| GSE69403 |
Interactions of melanoma cells with distal keratinocytes trigger metastasis via Notch signaling inhibition of MITF |
|
| Relations |
| BioSample |
SAMN03753658 |
| SRA |
SRX1044372 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM1700745_SA876_expression.txt.gz |
17.1 Kb |
(ftp)(http) |
TXT |
SRA Run Selector |
| Processed data provided as supplementary file |
| Raw data are available in SRA |
| Processed data are available on Series record |
|
|
|
|
 |
