|
|
GEO help: Mouse over screen elements for information. |
|
Status |
Public on Jun 30, 2019 |
Title |
N-37 |
Sample type |
SRA |
|
|
Source name |
Serum
|
Organism |
Homo sapiens |
Characteristics |
age: 47 gender: male race: white/not hispanic tissue: Serum cause of liver failure: Chronic hepatocellular disease: Nonalcoholic steatohepatitis library: 1
|
Extracted molecule |
total RNA |
Extraction protocol |
Total RNA was isolated from serum of patients after liver allograft transplantation and used for miRNA-sequencing and qPCR analysis. The small RNA libraries for the solid tissue samples were prepared using the protocol described in Hafner et al. (Methods, 2008; Methods, 2012) and Akat et al. (PNAS, 2014) with modifications: 1) The libraries were spiked with 2 cocktails comprising each 10 synthetic 22-nt oligoribonucleotides; the amount of each oligoribonucleotide was 1 amol, 10 amol total for each cocktail, 20 amol total in each sample. 2) The synthetic P32-labeled 19-nt and 24-nt ssRNAs used for size selection were not spiked-into the samples. The sequences for the 20 calibrator oligoribonucleotides are in the supplementary information of this publication. Directional RNA-seq (size-fractionation for RNAs 19- to 24-nt)
|
|
|
Library strategy |
miRNA-Seq |
Library source |
transcriptomic |
Library selection |
size fractionation |
Instrument model |
Illumina HiSeq 2500 |
|
|
Description |
barcode: TCCAC common 3'-adapter: TCGTATGCCGTCTTCTGCTTG complete 3'-adapter: TCCACTCGTATGCCGTCTTCTGCTTG Serum from patient with histologically normal liver biopsy.
|
Data processing |
Base calling was done using CASAVA versions 1.8.2. The data was processed as described in Brown et al. (2013, Front Genet, 4:145) using a curated miRNA and other non-coding and coding RNA transcriptomes (Akat et. al., PNAS 2014) Genome_build: GRCh37/hg19 Supplementary_files_format_and_content: The processed data files contain raw, i.e. not-normalized or transformed, miRNA counts based on unique, individual miRNA sequences, or based on precursor cistrons and sequence families.
|
|
|
Submission date |
Jun 04, 2015 |
Last update date |
Jun 30, 2019 |
Contact name |
Kemal Marc Akat |
E-mail(s) |
kakat@rockefeller.edu
|
Phone |
212-327-7645
|
Organization name |
The Rockefeller University
|
Lab |
Laboratory of RNA Molecular Biology, Thomas Tuschl
|
Street address |
1230 York Avenue
|
City |
New York |
State/province |
NY |
ZIP/Postal code |
10065 |
Country |
USA |
|
|
Platform ID |
GPL16791 |
Series (1) |
GSE69579 |
Circulating extracellular microRNAs predictive of human liver allograft status. |
|
Relations |
BioSample |
SAMN03761752 |
SRA |
SRX1048753 |
Supplementary data files not provided |
SRA Run Selector |
Raw data are available in SRA |
Processed data are available on Series record |
|
|
|
|
|