 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Jun 30, 2019 |
| Title |
AR-50 |
| Sample type |
SRA |
| |
|
| Source name |
Serum
|
| Organism |
Homo sapiens |
| Characteristics |
age: 46
gender: male
race: white/not hispanic
tissue: Serum
cause of liver failure: Chronic hepatocellular disease: Alcoholic liver disease
library: 3
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Total RNA was isolated from serum of patients after liver allograft transplantation and used for miRNA-sequencing and qPCR analysis.
The small RNA libraries for the solid tissue samples were prepared using the protocol described in Hafner et al. (Methods, 2008; Methods, 2012) and Akat et al. (PNAS, 2014) with modifications: 1) The libraries were spiked with 2 cocktails comprising each 10 synthetic 22-nt oligoribonucleotides; the amount of each oligoribonucleotide was 1 amol, 10 amol total for each cocktail, 20 amol total in each sample. 2) The synthetic P32-labeled 19-nt and 24-nt ssRNAs used for size selection were not spiked-into the samples. The sequences for the 20 calibrator oligoribonucleotides are in the supplementary information of this publication.
Directional RNA-seq (size-fractionation for RNAs 19- to 24-nt)
|
| |
|
| Library strategy |
miRNA-Seq |
| Library source |
transcriptomic |
| Library selection |
size fractionation |
| Instrument model |
Illumina HiSeq 2500 |
| |
|
| Description |
barcode: TAACG
common 3'-adapter: TCGTATGCCGTCTTCTGCTTG
complete 3'-adapter: TAACGTCGTATGCCGTCTTCTGCTTG
Serum from patient with histologically confirmed acute liver allograft rejection
|
| Data processing |
Base calling was done using CASAVA versions 1.8.2.
The data was processed as described in Brown et al. (2013, Front Genet, 4:145) using a curated miRNA and other non-coding and coding RNA transcriptomes (Akat et. al., PNAS 2014)
Genome_build: GRCh37/hg19
Supplementary_files_format_and_content: The processed data files contain raw, i.e. not-normalized or transformed, miRNA counts based on unique, individual miRNA sequences, or based on precursor cistrons and sequence families.
|
| |
|
| Submission date |
Jun 04, 2015 |
| Last update date |
Jun 30, 2019 |
| Contact name |
Kemal Marc Akat |
| E-mail(s) |
kakat@rockefeller.edu
|
| Phone |
212-327-7645
|
| Organization name |
The Rockefeller University
|
| Lab |
Laboratory of RNA Molecular Biology, Thomas Tuschl
|
| Street address |
1230 York Avenue
|
| City |
New York |
| State/province |
NY |
| ZIP/Postal code |
10065 |
| Country |
USA |
| |
|
| Platform ID |
GPL16791 |
| Series (1) |
| GSE69579 |
Circulating extracellular microRNAs predictive of human liver allograft status. |
|
| Relations |
| BioSample |
SAMN03761771 |
| SRA |
SRX1048772 |
| Supplementary data files not provided |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data are available on Series record |
|
|
|
|
 |
