|
| Status |
Public on Jul 04, 2018 |
| Title |
Chat17_GFP-Nova_CLIP_2 |
| Sample type |
SRA |
| |
|
| Source name |
Chat17_GFP-Nova_CLIP_pooled spinal cords
|
| Organism |
Mus musculus |
| Characteristics |
strain background: C57BL/6
age: 3-month-old
genotype/variation: Chat:GFP-Nova #17 hemizygous
tissue: Pooled spinal cords
|
| Extracted molecule |
total RNA |
| Extraction protocol |
HITS-CLIP was performed on freshly isolated spinal cords using anti-GFP antibodies. The monoclonal anti-GFP antibodies 19C8 and 19F7 from Memorial Sloan Kettering Antibody Facility were used.
partial RNAse digestion, 3' and 5' RNA linker ligation and two rounds of PCR amplificiation
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina HiSeq 1000 |
| |
|
| Description |
5' barcode: GANNNNG, 3' adaptor: GTGTCAGTCACTTCCAGCGG
GFP-Nova HITS-CLIP on pooled spinal cords from Chat:GFP-Nova #17, biological replicate 2
|
| Data processing |
library strategy: CLIP-seq
filter fastq files by quailty scores, min:0-6:20, mean:7-31:20, output FASTA
collapse exact sequences
strip 5' degenerate linker GANNNNG
remove 3' adaptor sequence (GTGTCAGTCACTTCCAGCGG)
align to mm9 using novoalign (unambigous mapping)
collapse of PCR duplicates
filter out reads immediately upstream of genomic GTGTC
Genome_build: mm14
Supplementary_files_format_and_content: bed files containing genomic coordinates of unique unambigously mapped reads; 9 column-BED, the 7th, 8th, and 9th columns are thickStart, thickEnd, and itemRgb.
|
| |
|
| Submission date |
Jul 24, 2015 |
| Last update date |
May 15, 2019 |
| Contact name |
Yuan Yuan |
| E-mail(s) |
yyuan01@rockefeller.edu
|
| Organization name |
The Rockefeller University
|
| Department |
Laboraotry of Molecular Neuro-Oncology
|
| Lab |
Robert Darnell
|
| Street address |
1230 York Ave
|
| City |
New York |
| State/province |
NY |
| ZIP/Postal code |
10065 |
| Country |
USA |
| |
|
| Platform ID |
GPL15103 |
| Series (1) |
| GSE71294 |
Cell type-specific HITS-CLIP reveals differential RNA processing in motor neurons |
|
| Relations |
| BioSample |
SAMN03921910 |
| SRA |
SRX1117162 |
