|
Status |
Public on Feb 17, 2016 |
Title |
HITS-CLIP_AD_14 |
Sample type |
SRA |
|
|
Source name |
advanced Alzheimer's Disease_brain
|
Organism |
Homo sapiens |
Characteristics |
disease status: advanced Alzheimer's Disease tissue: brain tissue subtype: dorsolateral prefrontal cortex
|
Growth protocol |
Frozen brain tissue from control and advanced AD subjects was obtained from the Mount Sinai Brain Bank.
|
Extracted molecule |
total RNA |
Extraction protocol |
Brain tissue was UV irradiated and subjected to nELAVL HITS-CLIP (detailed description in accompanying paper) partial RNAse digestion, RNA linker ligation and PCR amplificiation nELAVL bound fragments were ligated to a degenerate 5'linker and a 3'linker
|
|
|
Library strategy |
RNA-Seq |
Library source |
transcriptomic |
Library selection |
cDNA |
Instrument model |
Illumina HiSeq 2500 |
|
|
Description |
A14 advanced Alzheimer's Disease subject
|
Data processing |
filtering (min:0-3:20,mean:4-19:20,min:20-24,mean:25-60) collapsing of exact sequences stripping of degenerate linker (25nt; begins with index; ends with a G) removal of 3'adaptor (GTGTCAGTCACTTCCAGCGG) alignment with novoalign (unambigous mapping) collapsing of PCR duplicates Genome_build: hg18 Supplementary_files_format_and_content: bed file containing genomic coordinates of unique unambigously mapped reads
|
|
|
Submission date |
Sep 16, 2015 |
Last update date |
May 15, 2019 |
Contact name |
Claudia Scheckel |
E-mail(s) |
claudia.scheckel@gmail.com
|
Organization name |
University Hospital Zurich
|
Department |
Institute of Neuropathology
|
Street address |
Schmelzbergstrasse 12
|
City |
Zurich |
State/province |
NY |
ZIP/Postal code |
8091 |
Country |
Switzerland |
|
|
Platform ID |
GPL16791 |
Series (2) |
GSE53695 |
nELAVL HITS-CLIP in Alzheimer's Disease patients |
GSE53699 |
nELAVL HITS-CLIP and RNA-seq in Alzheimer's Disease patients and IMR-32 neuroblastoma cells |
|
Relations |
BioSample |
SAMN04089942 |
SRA |
SRX1250585 |