GEO Accession viewer

NCBI > GEO > Accession Display

Not logged in | Login

GEO help: Mouse over screen elements for information.

Sample GSM2086264

Query DataSets for GSM2086264

Status

Public on Dec 19, 2016

Title

PRO20150702_BatchB_replicate1

Sample type

SRA

Source name

HEK293

Organism

Homo sapiens

Characteristics

cell line: HEK293
batch: B

Growth protocol

HEK293 cells were cultured in DMEM medium supplemented with glutamine and 10% fetal calf serum.

Extracted molecule

total RNA

Extraction protocol

1000 HEK-293 cells in 4.5 ul C1 wash buffer (Fluidigm) were lysed with 9 ul of lysis buffer (0.2% w/v Tween 20, 1 U/ul Promega RNAsin RNAse inhibitor, 2 µM reverse transcription primer (TGCGGTATCTAAAGCGGTGAGT(30)VN), 2.5 mM dNTPs, 1x C1 loading reagent (Fluidigm), ERCC Spike-In Mix 1 @ 20,000 molecules/cell (Life Technologies). The sample was incubated for 10 min at room temperature followed by 3 min at 70°C and 3 min at 10°C.
Reverse transcription: 18 ul of 1.75 x reverse transcription mix, 8.75 mM DTT, 1.75 M Betaine, 10.5 mM MgCl2, 1.75 uM template switching oligonucleotide (GCAATGAAGTCGCAGGGTTGN(4)H(4)rGrGrG), 0.5 U/ul Promega RNAsin, 5.5 U/ul Life Technologies Superscript II reverse transcriptase, 1x C1 (Fluidigm) loading reagent were added to the lysed cells and the sample was incubated for 10 min at 25°C, 90 min at 42°C, 15 min at 70°C and kept below 10°C until PCR amplification. PCR amplification and barcoding: One tenth of the reverse transcription (3.15 µl, 100 cells) was mixed with 27 µl 1.15 x Kappa KAPAHiFiHiFi HotStart Ready Mix, 55 nM barcode primer (TGCGGTATCTAAAGCGGTGAGCCATCTCATCCCTGCGTGTCTCCGACTCAG<index>GCAATGAAGTCGCAGGGTTG, indices are Ion Torrent standard indices), 1.1 µM biotinylated PCR primer (Bio-TGCGGTATCTAAAGCGGTGAG). For PCR amplification samples were incubated 3 min at 98°C followed by 18 cycles at 98°C for 20 sec, 64°C for 15 sec, 72°C for 6 min, and a final extension at 72°C for 5 min. Fragmentation and library preparation: PCR products were fragmented by tagmentation with EzTn5 transposase (Epicentre) and Tn5 mosaic end duplexes (upper: 5’-AGA TGT GTA TAA GAG ACA-3’, lower: 5’-PhosCTG TCT CTT ATA CAC ATC T-3’), 5’ terminal (biotinylated) fragments were isolated with streptavidin beads and and Ion Torrent adapter sequences were added by PCR (Primers: CCATCTCATCCCTGCGTGTCTC, 0.5 μM; CCACTACGCCTCCGCTTTCCTC, 0.5 μM; CCACTACGCCTCCGCTTTCCTCTCTATGGGCAGTCGGTGATAGATGTGTATAAGAGACAG, 0.125 μM).
5' selective, oligo-dT-primed RNA-seq based on the SmartSeq technique.

Library strategy

RNA-Seq

Library source

transcriptomic

Library selection

cDNA

Instrument model

Ion Torrent Proton

Description

PRO20150626_0207_dge_ed1.txt

Data processing

Cutadapt-1.2.1 of 3p adaptor 'CTGTCTCTTATACACATCT',
Discarding of trimmed reads with length < 50b,
Filtering of reads not starting with a perfect 14b 5p adaptor 'AAGTCGCAGGGTTG', then a well formatted HUMI sequence (N4H4) followed by at least 3 'G' before template sequence,
Extraction of 5p adaptor, UMI and strech of 'G',
Mapping with STAR_2.4.0a versus hg19,
Drop-seq_tools-1.0 dropseq.jar tool for tagging with Gene information from Ensembl release GRCh37.75, then DigitalExpression calling with default parameters (edit distance=1).
Genome_build: hg19
Supplementary_files_format_and_content: PRO20150626_0207_dge_ed1.txt: quantifcation file containing for each gene detected in at least one sample the number of mRNA molecules counted for this gene.

Submission date

Mar 11, 2016

Last update date

May 15, 2019

Contact name

Kevin Lebrigand

Organization name

IPMC/CNRS

Lab

Functional Genomics Platform of Nice-Sophia-Antipolis, France.

Street address

660 route des lucioles