 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Sep 24, 2016 |
| Title |
Ecoli_DMS_vivo |
| Sample type |
SRA |
| |
|
| Source name |
E.coli
|
| Organism |
Escherichia coli |
| Characteristics |
probe: 8% DMS
conditions: In vivo, 37°C, 5min
rt cation: 150mM K+
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Cells were treated with lysozyme at RT for 5 min. Total RNA was extracted with hot acid phenol.
The DMS-seq protocol (Rouskin et al. 2014) was adapted to detect RT stops in unmodified RNA. Poly(A)-selected RNA was denatured at 95°C for 2 minutes. 1X RNA-fragmentation reagent (Ambion) was added and mixed at 95°C for additional 1 minute before 20 mM EDTA was added to the mixture to stop the fragmentation. After ethanol precipitation, RNA fragments were dephosphorylated at their 3′ ends using T4 polynucleotide kinase (New England BioLabs). 60−80 nt RNA fragments were gel-purified and ligated to a pre-adenylated 3′ DNA adapter (AppTCGTATGCCGTCTTCTGCTTGddC). Products of the expected size (82−102 nt) were gel-purified and resuspended in 6 µl water. For reverse transcription, 1 µl 0.2 M Tris-Cl (pH 7.5), 1 µl 1.5 M KCl (or NaCl or LiCl), 0.5 µl 60 mM MgCl2, 0.5 µl 10 mM dNTP mix and 0.5 µl 1 µM 5′-radiolabeled primer (32p-NNNNNNGATCGTCGGACTGTAGAACTCTGAACCTGTCG/iSp18/CAAGCAGAAGACGGCATACG, in which N is any nucleotide, and iSp18 is an 18-atom hexa-ethyleneglycol spacer, IDT) were added to the RNA template. The mixture was incubated at 80°C for 2 minutes then cooled down to 42°C and incubated for additional 2 minutes before adding 100 U SuperScript III reverse transcriptase (Invitrogen). After incubation at 42°C for 10 minutes, the reaction was stopped with addition of 1 µl 1 M NaOH, and the mixture was heated at 98°C for 15 minutes to hydrolyze the RNA. cDNAs from extension that stalled after addition of 20−45 nt were separated from primers and full-length cDNAs on a 10% urea gel, eluted and precipitated. Purified cDNA fragments were circularized using 50 U CircLigase (Epicentre) at 60°C for 4 hours before inactivation at 80°C for 10 minutes. Circularized cDNAs were amplified using a 5′ indexed primer (AATGATACGGCGACCACCGACAGGTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACxxxxxxATCCGACAGGTTCAGAGTTCTACAGTCCGA, in which xxxxxx is the multiplexing index), a common 3′ primer (CAAGCAGAAGACGGCATACGA), and Platinum Taq DNA Polymerase High Fidelity (Invitrogen) for 10–13 cycles of PCR. Libraries were purified on an 8% formamide gel and sequenced on a HiSeq 2000 sequencing machine (Illumina; 40 cycles, single-end mode).
|
| |
|
| Library strategy |
OTHER |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
Illumina HiSeq 2000 |
| |
|
| Description |
rRNA-depleted RNA
|
| Data processing |
Library strategy: DMS-seq
The six random nucleotides of the RT primer reduced circLigase bias and enabled the removal of PCR-duplicated sequences.
After removing these duplicates, the first six nucleotides and the 3′-adapter sequences were trimmed using FASTX tools.
The trimmed sequences were aligned to the reference transcriptome using Bowtie, requiring unique mapping and allowing one mismatch.
For each read, the nucleotide immediately upstream of the first aligned position was annotated as an RT stop.
At each position i of the transcriptome with ≥ 3 RT-stop reads, a fold-enrichment value (f) for RT stops was calculated as the ratio between the number of reads stalled at position i and the average number of reads over all positions of the same nucleotide within the same transcript (e.g. all G nucleotides) using an in-house perl script.
Genome_build: mm10 RefSeq, hg19 RefSeq, Saccharomyces Genome Database version 2015-1-13, E. coli RefSeq
Supplementary_files_format_and_content: Tab-delimited files containing the position of RT stop, base identity, raw RT-stop read count and fold enrichment.
|
| |
|
| Submission date |
Jun 22, 2016 |
| Last update date |
May 15, 2019 |
| Contact name |
Junjie Guo |
| E-mail(s) |
jguo@wi.mit.edu
|
| Organization name |
Whitehead Institute
|
| Lab |
David Bartel
|
| Street address |
9 Cambridge Center
|
| City |
Cambridge |
| State/province |
MA |
| ZIP/Postal code |
02142 |
| Country |
USA |
| |
|
| Platform ID |
GPL14548 |
| Series (1) |
| GSE83617 |
Global analyses of RNA G-quadruplexes |
|
| Relations |
| BioSample |
SAMN05282308 |
| SRA |
SRX1870261 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM2211030_ecoli_dms_vivo.txt.gz |
2.9 Mb |
(ftp)(http) |
TXT |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
