 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Dec 19, 2016 |
| Title |
PRO20150702_C1_18 |
| Sample type |
SRA |
| |
|
| Source name |
HEK293
|
| Organism |
Homo sapiens |
| Characteristics |
cell line: HEK293
|
| Growth protocol |
HEK293 cells were cultured in DMEM medium supplemented with glutamine and 10% fetal calf serum.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
HEK-293 cells were loaded onto a Fluidigm 96 cell IFC and lyzed with 0.2% w/v Tween 20, 1 U/ul Promega RNAsin RNAse inhibitor, 2 µM reverse transcription primer (TGCGGTATCTAAAGCGGTGAGT(30)VN), 2.5 mM dNTPs, 1x C1 loading reagent (Fluidigm), ERCC Spike-In Mix 1 @ 20,000 molecules/cell (Life Technologies). Cells were lyzed for 10 min at room temperature followed by 3 min at 70°C and 3 min at 10°C.
Cells were processed in a 96 cell Fluidigm C1 IFC. Reverse transcription: 18 nl of 1.75 x reverse transcription mix, 8.75 mM DTT, 1.75 M Betaine, 10.5 mM MgCl2, 1.75 uM template switching oligonucleotide (GCAATGAAGTCGCAGGGTTGN(4)H(4)rGrGrG), 0.5 U/ul Promega RNAsin, 5.5 U/ul Life Technologies Superscript II reverse transcriptase, 1x C1 loading reagent were added to each lysed cell and incubated for 10 min at 25°C, 90 min at 42°C, 15 min at 70°C. PCR amplification: 270 nl 1.15 x KAPAHiFi HotStart Ready Mix, 55 nM barcode primer (TGCGGTATCTAAAGCGGTGAGCCATCTCATCCCTGCGTGTCTCCGACTCAG<index>GCAATGAAGTCGCAGGGTTG, indices were standard ion torrent barcodes) and 1.1 µM biotinylated PCR primer were back-loaded to each cell. PCR amplification was for 3 min at 98°C followed by 18 cycles at 98°C for 20 sec, 64°C for 15 sec, 72°C for 6 min, and a final extension at 72°C for 5 min. Fragmentation and library preparation: Barcoded, amplified cDNA from all cells was pooled and fragmented by tagmentation with EzTn5 transposase (Epicentre) and Tn5 mosaic end duplexes (upper: 5’-AGA TGT GTA TAA GAG ACA-3’, lower: 5’-PhosCTG TCT CTT ATA CAC ATC T-3’), 5’ terminal (biotinylated) fragments were isolated with streptavidin beads and Ion Torrent adapter sequences were added by PCR (Primers: CCATCTCATCCCTGCGTGTCTC, 0.5 μM; CCACTACGCCTCCGCTTTCCTC, 0.5 μM; CCACTACGCCTCCGCTTTCCTCTCTATGGGCAGTCGGTGATAGATGTGTATAAGAGACAG, 0.125 μM).
5' selective, oligo-dT-primed RNA-seq based on the SmartSeq technique.
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Ion Torrent Proton |
| |
|
| Description |
PRO20150702_C1_18
|
| Data processing |
Cutadapt-1.2.1 of 3p adaptor 'CTGTCTCTTATACACATCT',
Discarding of trimmed reads with length < 50b,
Filtering of reads not starting with a perfect 14b 5p adaptor 'AAGTCGCAGGGTTG', then a well formatted HUMI sequence (N4H4) followed by at least 3 'G' before cDNA sequence,
Extraction of 5p adaptor, UMI and strech of 'G',
Mapping with STAR_2.4.0a versus hg19 using encodeproject.org RNA-seq options "--outFilterType BySJout --outFilterMultimapNmax 20 --alignSJoverhangMin 8 --alignSJDBoverhangMin 1 --outFilterMismatchNmax 999 --outFilterMismatchNoverLmax 0.04 --alignIntronMin 20 --alignIntronMax 1000000 --alignMatesGapMax 1000000"
Drop-seq_tools-1.0 dropseq.jar tool for tagging with Gene information from Ensembl release GRCh37.75, then DigitalExpression calling with default parameters (edit distance=1).
Genome_build: hg19
Supplementary_files_format_and_content: PRO20150702_C1_dge_ed1_38cells.txt: quantifcation file containing for each gene detected in at least one sample the number of mRNA (unique molecular identifier) molecules counted for this gene.
|
| |
|
| Submission date |
Oct 27, 2016 |
| Last update date |
May 15, 2019 |
| Contact name |
Kevin Lebrigand |
| Organization name |
IPMC/CNRS
|
| Lab |
Functional Genomics Platform of Nice-Sophia-Antipolis, France.
|
| Street address |
660 route des lucioles
|
| City |
Valbonne - Sophia-Antipolis |
| ZIP/Postal code |
06560 |
| Country |
France |
| |
|
| Platform ID |
GPL17303 |
| Series (2) |
| GSE79136 |
A cost effective single cell RNA sequencing approach for the Fluidigm C1 |
| GSE89234 |
Transcriptome profiling of single HEK293 cells with UMIs on Ion Torrent Proton (Run 20150702) |
|
| Relations |
| BioSample |
SAMN05948159 |
| SRA |
SRX2273440 |
| Supplementary data files not provided |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data are available on Series record |
|
|
|
|
 |
