NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM2362542 Query DataSets for GSM2362542
Status Public on Dec 19, 2016
Title PRO20160225_C1_22
Sample type SRA
 
Source name HEK293
Organism Homo sapiens
Characteristics cell line: HEK293
Growth protocol HEK293 cells were cultured in DMEM medium supplemented with glutamine and 10% fetal calf serum.
Extracted molecule total RNA
Extraction protocol HEK-293 cells were loaded onto a Fluidigm 96 cell IFC and lyzed with 0.2% w/v Tween 20, 1 U/ul Promega RNAsin RNAse inhibitor, 2 µM reverse transcription primer (TGCGGTATCTAAAGCGGTGAGT(30)VN), 2.5 mM dNTPs, 1x C1 loading reagent (Fluidigm), ERCC Spike-In Mix 1 @ 20,000 molecules/cell (Life Technologies). Cells were lyzed for 10 min at room temperature followed by 3 min at 70°C and 3 min at 10°C.
Cells were processed in a 96 cell Fluidigm C1 IFC. Reverse transcription: 18 nl of 1.75 x reverse transcription mix, 8.75 mM DTT, 1.75 M Betaine, 10.5 mM MgCl2, 1.75 uM template switching oligonucleotide (GCAATGAAGTCGCAGGGTTGN(4)H(4)rGrGrG), 0.5 U/ul Promega RNAsin, 5.5 U/ul Life Technologies Superscript II reverse transcriptase, 1x C1 loading reagent were added to each lysed cell and incubated for 10 min at 25°C, 90 min at 42°C, 15 min at 70°C. PCR amplification: 270 nl 1.15 x KAPAHiFi HotStart Ready Mix, 55 nM barcode primer (TGCGGTATCTAAAGCGGTGAGCCATCTCATCCCTGCGTGTCTCCGACTCAG<index>GCAATGAAGTCGCAGGGTTG, indices were standard ion torrent barcodes) and 1.1 µM biotinylated PCR primer were back-loaded to each cell. PCR amplification was for 3 min at 98°C followed by 18 cycles at 98°C for 20 sec, 64°C for 15 sec, 72°C for 6 min, and a final extension at 72°C for 5 min. Fragmentation and library preparation: Barcoded, amplified cDNA from all cells was pooled and fragmented by tagmentation with EzTn5 transposase (Epicentre) and Tn5 mosaic end duplexes (upper: 5’-AGA TGT GTA TAA GAG ACA-3’, lower: 5’-PhosCTG TCT CTT ATA CAC ATC T-3’), 5’ terminal (biotinylated) fragments were isolated with streptavidin beads and Ion Torrent adapter sequences were added by PCR (Primers: CCATCTCATCCCTGCGTGTCTC, 0.5 μM; CCACTACGCCTCCGCTTTCCTC, 0.5 μM; CCACTACGCCTCCGCTTTCCTCTCTATGGGCAGTCGGTGATAGATGTGTATAAGAGACAG, 0.125 μM).
5' selective, oligo-dT-primed RNA-seq based on the SmartSeq technique.
 
Library strategy RNA-Seq
Library source transcriptomic
Library selection cDNA
Instrument model Ion Torrent Proton
 
Description PRO20160225_C1_22
Data processing Cutadapt-1.2.1 of 3p adaptor 'CTGTCTCTTATACACATCT',
Discarding of trimmed reads with length < 50b,
Filtering of reads not starting with a perfect 14b 5p adaptor 'AAGTCGCAGGGTTG', then a well formatted HUMI sequence. The UMI sequence was N6H4. We analyzed only N4H4 part of the UMI for compatibility with replicates where a N4H4 UMI was used. We require a well formated N4H4 HUMI followed by at least 3 'G' before cDNA sequence
Extraction of 5p adaptor, UMI and strech of 'G',
Mapping with STAR_2.4.0a versus hg19 using encodeproject.org RNA-seq options "--outFilterType BySJout --outFilterMultimapNmax 20 --alignSJoverhangMin 8 --alignSJDBoverhangMin 1 --outFilterMismatchNmax 999 --outFilterMismatchNoverLmax 0.04 --alignIntronMin 20 --alignIntronMax 1000000 --alignMatesGapMax 1000000"
Drop-seq_tools-1.0 dropseq.jar tool for tagging with Gene information from Ensembl release GRCh37.75, then DigitalExpression calling with default parameters (edit distance=1).
Genome_build: hg19
Supplementary_files_format_and_content: PRO20160225_C1_dge_ed1_76cells.txt: quantifcation file containing for each gene detected in at least one sample the number of mRNA (unique molecular identifier) molecules counted for this gene.
 
Submission date Oct 27, 2016
Last update date May 15, 2019
Contact name Kevin Lebrigand
Organization name IPMC/CNRS
Lab Functional Genomics Platform of Nice-Sophia-Antipolis, France.
Street address 660 route des lucioles
City Valbonne - Sophia-Antipolis
ZIP/Postal code 06560
Country France
 
Platform ID GPL17303
Series (2)
GSE79136 A cost effective single cell RNA sequencing approach for the Fluidigm C1
GSE89235 Transcriptome profiling of single HEK293 cells with UMIs on Ion Torrent Proton (Run 20160225)
Relations
BioSample SAMN05948268
SRA SRX2273488

Supplementary data files not provided
SRA Run SelectorHelp
Raw data are available in SRA
Processed data are available on Series record

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap