|
Status |
Public on Aug 17, 2017 |
Title |
Lin37 rescue clone 411-27 sample 1 |
Sample type |
SRA |
|
|
Source name |
NIH3T3 mouse fibroblasts
|
Organism |
Mus musculus |
Characteristics |
cell line: NIH3T3 genotype: Lin37 rescue cell cycle stage: G0 / quiescent
|
Treatment protocol |
Cells were cultivated in DMEM containing 0% FCS for 60h prior to RNA extraction
|
Growth protocol |
Cells were maintained in DMEM containing 10% FCS.
|
Extracted molecule |
total RNA |
Extraction protocol |
RNA was extracted with the qiagen Rneasy kit 100 ng of total RNA were fragmented by adding fragmentation buffer (200 mM Tris acetate, pH 8.2, 500 mM potassium acetate and 150 mM magnesium acetate) and heating at 94 °C for 3 min followed by ethanol precipitation with ammonium acetate and GlycoBlue (Life Technologies) as carrier. Fragmented RNA was further processed using the Ovation Human FFPE RNA-Seq Library Systems (Nugen) according to the instructions of the manufacturer. The barcoded libraries were purified and quantified using the Library Quantification Kit - Illumina/Universal (KAPA Biosystems).
|
|
|
Library strategy |
RNA-Seq |
Library source |
transcriptomic |
Library selection |
cDNA |
Instrument model |
Illumina HiScanSQ |
|
|
Description |
Sample name: 411-27_Lin37-rescue_1 rRNA depleted RNA
|
Data processing |
Illumina’s HiSeq Control Software (HCS) used for basecalling. adapter was clipped using cutadapt with a minimum length of 12 with AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC as adapter for mate 1 and AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT as adapter for mate 2 Segemehl 0.2.0 was used for alignment to mm10 genome assembly with default parameters and split read mapping enabled RPKMs on gencode vM5 were computed using rnacounter 1.5.2 with default parameters except -nh flag enabled Insert sizes for non-split reads computed with CollectInsertSizeMetrics.jar form picard-tools 1.89 Genome_build: mm10 Supplementary_files_format_and_content: tab delimited file containing RPKM values for each sample
|
|
|
Submission date |
Apr 12, 2017 |
Last update date |
May 15, 2019 |
Contact name |
Gerd A Müller |
E-mail(s) |
gerd.mueller@medizin.uni-leipzig.de
|
Phone |
+493419723636
|
Organization name |
University of Leipzig
|
Department |
Medical School
|
Lab |
Molecular Oncology
|
Street address |
Semmelweisstrasse 14
|
City |
Leipzig |
ZIP/Postal code |
04103 |
Country |
Germany |
|
|
Platform ID |
GPL16173 |
Series (1) |
GSE97716 |
Lin37 is essential for repression of cell-cycle genes in quiescence |
|
Relations |
BioSample |
SAMN06712886 |
SRA |
SRX2734295 |