|
Status |
Public on May 01, 2010 |
Title |
p53-/- HCT116 40 Hrs |
Sample type |
SRA |
|
|
Source name |
Lentiviruses integrated in genomic DNA
|
Organism |
Homo sapiens |
Characteristics |
cell line: P53 deficient human colorectal HCT116
|
Growth protocol |
The Open Biosystems pGIPZ lentiviral shRNA library was obtained through the University of Massachusetts Medical School shRNA library core facility. Twelve lentiviral pools, each comprising ~5000 shRNA clones, were generated with titers of ~2.106 pfu/ml. These lentiviral stocks were produced following co-transfection with the packaging mix into the 293T packaging cell line.
HCT116 WT and and HCT116 P53-/- were plated at 1 Million cells per 100mm plate and transduced the next day with one pool/plate of ShRNA lentivirus library at a MOI of 1. Forty hours after transfection 75% of the cells were fluorescent and each plate was split in two. Half of the cells were transferred in 150mm plates for further growth while the remaining part was pooled and the genomic DNA was extracted, and the purified DNA provided the early reference point for HCT116 WT and HCT116 P53-/- transduced populations. The remaining cells were passaged by four-fold dilutions in the 150mm plates for 10 days at which point the cells were pooled and the genomic DNA was extracted for the two cell lines. This provided the end point for HCT116 WT and HCT116 P53-/- transduced populations.
|
Extracted molecule |
genomic DNA |
Extraction protocol |
Genomic DNA was extracted by sequential proteinase K treatment, phenol/chloroform extraction and spooling after addition of 2 volumes of ethanol.
To analyze the frequency of individual lentiviruses in the four populations, 72ug of genomic DNA was used as substrate (split in 24 tubes) and amplified for 15 cycles with GIPZF (GAGTTTGTTTGAATGAGGCTTCAGTAC) and GIPZHR (CGCGTCCTAGGTAATACGAC) primers. The PCR product was gel purifed and 50 ng was used as substrate for a second 15 cycles PCR with Forward Acu1 primer (AMN5¹-CAACAGAAGGCTCCTGAAGGTATATTGCTGTTGA) and Reverse Acu 1 primer (AMN5¹-AAATTTAAACTGAAGTACATCTGTGGCTTCACTA); One ug of the PCR product was digested to completion with Acu 1 (New England Biolabs) according to the manufacturer instructions. The digested product was ligated to the following pre-annealed adapters: L1ShSolexA/5bio/-ACACTCTTTCCCTACACGACGCTCTTCCGATCTCA L1ShSolexB/5Phos/-AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT/3AmM and L2ShSolexB/5Phos/-AGATCGGAAGAGCTCGTATGCCGTCTTCTGCTTG/3BIO/L2ShSolexA/5AmMC6/-CAAGCAGAAGACGGCATACGAGCTCTTCCGATCTAC. The product of the 3 way ligation was run on a 3% TAE agarose gel, visualized with ethidium bromide, purified and used as a substrate for a 15 cycle PCR reaction using Illumina primers 1.1 and 2.1 as recommended by the manufacturer.
|
|
|
Library strategy |
OTHER |
Library source |
genomic |
Library selection |
PCR |
Instrument model |
Illumina Genome Analyzer |
|
|
Description |
p53-/- human colorectal HCT116 cell lines was stably transduced with a short hairpin RNA (shRNA) library encoded by lentiviruses
|
Data processing |
Illumina Genome analyzer pipeline, text file poste filtering, alignment and clustering
|
|
|
Submission date |
May 05, 2009 |
Last update date |
May 15, 2019 |
Contact name |
Michael R. Green |
E-mail(s) |
michael.green@umassmed.edu
|
Organization name |
University of Massachusetts Medical School
|
Department |
Molecular, Cell and Cancer Biology
|
Lab |
Michael R. Green
|
Street address |
364 Plantation Street
|
City |
Worcester |
State/province |
MA |
ZIP/Postal code |
01605 |
Country |
USA |
|
|
Platform ID |
GPL9052 |
Series (1) |
GSE15967 |
Identification of Genes Preferentially Required for Growth of p53-Deficient Human Cancer Cells |
|
Relations |
SRA |
SRX021109 |
BioSample |
SAMN00013985 |