NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM438364 Query DataSets for GSM438364
Status Public on Oct 13, 2009
Title Sequencing of small RNA from the IMR90 cell line; smRNA-seq_imr90_r1
Sample type SRA
 
Source name Sequencing of small RNA from the IMR90 cell line
Organism Homo sapiens
Characteristics disease: None
biomaterial_provider: ATCC
biomaterial_type: Cell Line
line: IMR90
lineage: NA
batch: 1
differentiation_stage: Fetal lung fibroblast
differentiation_method: NA
passage: 4
medium: Minimum Essential Medium, Eagle with Earle's Balanced Salt Solution supplemented with 10% Fetal Bovine Serum (FBS), 1% Pen/Strep (penicillin, streptomycin), 1% GlutaMax (stable form of glutamine)
Sex: Female
experiment_type: smRNA-Seq
extraction_protocol: mirVana miRNA isolation kit (Applied Biosystems), performed as per manufacturer's instructions to isolate small RNAs, followed by treatment with DNaseI (Qiagen) for 30 min at room temperature.
extraction_protocol_smrna_enrichment: The small RNA fraction were separated by electrophoresis on a 15% TBE-urea gel and RNA molecules between approximately 10 and 50 nt were excised and eluted from the gel fragments then ethanol precipitated, resuspending in 6 µl.
smrna_preparation_initial_smrna_qnty: Equivalent to the quantity of smRNAs isolated from 5 µg of total RNA.
rna_preparation_5'_rna_adapter_sequence: 5' GUUCAGAGUUCUACAGUCCGACGAUC
rna_preparation_3'_rna_adapter_sequence: 5' UCGUAUGCCGUCUUCUGCUUGidT, 5' adenylated (Illumina)
rna_preparation_reverse_transcription_primer_sequence: 5' CAAGCAGAAGACGGCATACGA
rna_preparation_3'_rna adapter_ligation_protocol: 1 µl of 1:10 diluted adenylated 3’ RNA adapter oligonucleotide was added to the 6 µl of smRNA and incubated at 70˚C for 2 min followed by placement on ice. The 3’ RNA adapter ligation reaction was performed by addition of 2 µl 5x T4 RNA ligase 2 truncated ligation buffer, 20 U RNaseOut and 300 U T4 RNA ligase 2 truncated (New England Biolabs) and incubation at 22˚C for 1 h.
rna_preparation_5'_rna_adapter_ligation_protocol: Ligation of the 5’ RNA adapter was performed by addition to the 3’ adapter ligated reaction of 0.5 µl heat denatured (70˚C 2 min) 5’ RNA adapter oligonucleotide, 1 µl 10 mM ATP, and 10 U T4 RNA ligase (Promega), and incubation at 20˚C for 6 h.
rna_preparation_reverse_transcription_protocol: To 4 µl of the RNA ligation products, 1 µl 1:5 diluted RT primer was added and heat denatured (70˚C 2 min), followed by incubation on ice. Added to the denatured RNA/primer solution was 2 µl 5x first strand buffer, 0.5 µl 12.5 mM dNTPs, 1 µl 100 mM DTT, and 20 U RNaseOut, followed by incubation at 48˚C for 3 min. To this, 100 U Superscript II reverse transcriptase (Life Technologies) was added, followed by incubation at 44˚C for 1 h.
library_generation_pcr_template: The entire reverse transcription reaction was used in the PCR enrichment of the library.
library_generation_pcr_polymerase_type: Phusion hot-start high fidelity DNA polymerase (New England Biolabs). 1x Phusion polymerase buffer and 2 U Phusion hot-start high fidelity DNA polymerase was used in a 50 µl total reaction.
library_generation_pcr_thermocycling_program: 98˚C 30 sec; 98˚C 10 sec, 60˚C 30 sec, 72˚C 15 sec; 72˚C 10 min
library_generation_pcr_number_cycles: 12
library_generation_pcr_f_primer_sequence: 5' AATGATACGGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGA
library_generation_pcr_r_primer_sequence: 5' CAAGCAGAAGACGGCATACGA
library_generation_pcr_primer_conc: 0.25 µM
library_generation_pcr_product_isolation_protocol: PCR products were separated by electrophoresis on a 6% polyacrylamide gel and the PCR products (~90-125 bp) were excised, eluted from the crushed gel by rotation in 100 µl 1x gel elution buffer for 2 h, then ethanol precipitation of the DNA within the supernatant.
Extracted molecule total RNA
Extraction protocol Library construction protocol: The small RNA fraction was isolated from IMR90 cells then sequentially ligated to the adenylated 3' RNA adapter then to the 5' RNA adapter. Following reverse transcription of the adapter ligated small RNAs, the library was enriched by 12 cycles of PCR.
 
Library strategy RNA-Seq
Library source transcriptomic
Library selection cDNA
Instrument model Illumina Genome Analyzer II
 
Description sample_term_id: EFO_0001196
assay_term_id: OBI_0001271
nucleic_acid_term_id: SO_0000276
Library name: smRNA-seq_imr90_r1
EDACC Genboree Sample Page:
http://genboree.org/java-bin/project.jsp?projectName=XML%20Submissions%2FUCSD%2FSAMPLE%2FEDACC.1121
EDACC Genboree Experiment Page:
http://genboree.org/java-bin/project.jsp?projectName=XML%20Submissions%2FUCSD%2FEXPERIMENT%2FEDACC.1439

****************
For data usage terms and conditions, please refer to:
http://www.drugabuse.gov/funding/funding-opportunities/nih-common-fund/epigenomics-data-access-policies
****************
Data processing Various levels of processed data files will be made available as this project proceeds.
 
Submission date Aug 11, 2009
Last update date May 15, 2019
Contact name UCSD AND SALK
Organization name University of California, San Diego
Street address Health Sciences Drive
City La Jolla
State/province CA
ZIP/Postal code 92092
Country USA
 
Platform ID GPL9115
Series (1)
GSE16256 UCSD Human Reference Epigenome Mapping Project
Relations
SRA SRX007168
BioSample SAMN00004463

Supplementary data files not provided
SRA Run SelectorHelp
Raw data are available in SRA

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap