|
Status |
Public on Dec 24, 2009 |
Title |
Human_PTB_CLIP-seq_M2 |
Sample type |
SRA |
|
|
Source name |
Hela cells
|
Organism |
Homo sapiens |
Characteristics |
cell line: Hela clip antibody: monoclonal anti-PTB antibody (BB7) library source: monomeric PTB-RNA complex
|
Growth protocol |
HeLa cells were grown in Dulbecco’s modified Eagle’s medium (DMEM) with 10% newborn bovine serum plus 100 U penicillin /streptomycin (Gibico) at 37°C in 5% CO2.
|
Extracted molecule |
total RNA |
Extraction protocol |
HeLa cells were UV-irradiated at 400 mj and collected by scraping the cells from 15-cm plates. 3' adaptor was first added to immunoprecipitated PTB-RNA complex, then 10% Novex NUPAGE gel was applied to separate monomeric and dimeric form of complexes. After transfering to NC membrane, corresponding bands were cut and RNA was extracted, separately. After 5' adaptor ligation, RT-PCR was performed following Super Script III product manual.
|
|
|
Library strategy |
RNA-Seq |
Library source |
transcriptomic |
Library selection |
cDNA |
Instrument model |
Illumina Genome Analyzer |
|
|
Description |
library from monomeric PTB-RNA complex 5’ adaptor: Biotin – 5'-AAUGAUACGGCGACCACCGA-3', 3' adaptor: 5' UCGUAUGCCGUCUUCUGCUUG -3'-puromycin. library strategy (original submitter annotation): CLIP-seq library selection (original submitter annotation): CLIP
|
Data processing |
Sequence reads were obtained using the Illumina Genome Analyzer. Alignment: Sequence reads were obtained using the Illumina Genome Analyzer. After removal of primer dimmer, the tags longer than 18nt were mapped to the human genome sequence (firstly mapped to hg17 and then coordinates were liftovered to hg18) by allowing 2 mismatches, 2 insertions or deletions, and only those with maximal identity (≥90%) were kept. Peaks: The four alignment files were combined together for peak finding, as we found that most of the monomeric and dimeric tags are similarly distributed in the genome with high pearson correlation coefficient. The method to detect the peaks above gene-specific randomized background was similar to (Yeo et al., 2009) and described in the paper (Xue et al., 2009).
|
|
|
Submission date |
Dec 07, 2009 |
Last update date |
May 15, 2019 |
Contact name |
Xiang-Dong Fu |
Organization name |
UC San Diego
|
Department |
CMM
|
Lab |
George Palade Laboratories
|
Street address |
9500 Gilman Drive, Room 231
|
City |
La Jolla |
State/province |
CA |
ZIP/Postal code |
92093-0651 |
Country |
USA |
|
|
Platform ID |
GPL9052 |
Series (1) |
|
Relations |
SRA |
SRX016020 |
BioSample |
SAMN00008207 |